Genetic load and junk.

Mung, to petrushka, elsewhere:

Everyone does not understand “genetic load” and those that do claim to understand are probably wrong. Why don’t you start an OP on genetic load and the genetic load argument? That would be interesting. Betting you won’t.

This is such an OP. I believe the genetic load argument*** was initially proposed by Susumu Ohno in 1972, whose paper also introduced the then-scare-quoted term “junk”. It’s brief, accessible, and worth a read for anyone who wishes to offer an opinion/understand (not necessarily in that order).

The short version: sequence-related function must be subject to deleterious mutations. Long genomes (such as those of most eukaryotes) contain too many bases for the entire genome to be considered functional in that way, given known mutation rates. The bulk of such genomes must either have functions that are not related to sequence, or no function at all.

Interestingly, the paper is hosted on the site of an anti-junk-er, Andras Pellionisz, a self-promoting double-PhD’d … er … maverick. Also of interest is that, contrary to some ID narratives, the idea was initially resisted by ‘Darwinists’, if that term is understood not as people who simply accept evolution, but as people who place most emphasis on Natural Selection. Perfectionism is not the sole preserve of Creationists.

More recent work has characterised the nonfunctional fraction, and this lends considerable empirical support to Ohno’s contentions.

[eta: link to comment]
***[eta: in relation to genome size, not the first time anyone, ever, discussed genetic load!]

209 thoughts on “Genetic load and junk.”

  1. It does seem weird to inist that there are supposed 3D DNA structures that are vital to the unrolling of specific phenotypes yet they cannot suffer deleterious mutations to primary sequence.

  2. Allan Miller:
    It does seem weird to inist that there are supposed 3D DNA structures that are vital to the unrolling of specific phenotypes yet they cannot suffer deleterious mutations to primary sequence.

    Yeah that simply doesn’t make sense. 3D DNA structure has sequence redundancy to some extent (in the same way the genetic code has 3rd position redundancy), since some sequences of bases, despite not being identical, still produce similar shapes. But that doesn’t mean it is sequence independent. It clearly isn’t, it take certain sequences to produce certain shapes.

  3. Allan Miller:
    CharlieM,

    The cells and everything in them are manufactured from sequences held in DNA – including DNA itself. This one has been done to death.

    No-one focusses solely on DNA sequence. That’s a ludicrous straw man.

    I’m afraid that this is just the way we are taught to think of DNA, we can’t help it. For the average person, our concept of DNA is as a pair of intertwining strings of beads being duplicated or sending out their messages in order to form the building blocks of the organism. This is an abstraction which does not mirror reality. The cell uses DNA in a similar way to a concert pianist using her or his fingers to make music.

  4. CharlieM: But when we start to see multiple and interlacing codes and constraints, accidental beneficial changes become increasingly unlikely to produce anything substantial.

    Rumraket: Why? You claim it here, but no argument follows. Explain why you think it is so, and then back it up with concrete real-world experiments.

    Phoodoo is very impressed with mere assertion, I’m not. Why does the fact that DNA is in interaction with the intra and extracellular environment (and that to understand the organism fully, we must understand these interactions) make evolution less probable? Why?

    It doesn’t make evolution less possible, it makes unguided evolution less possible.

    If you have a sentence that can make sense by being read forwards and by being read backwards and can also make sense if certain words or phrases are extracted and rearranged, then it becomes more difficult to alter certain areas or letters and retain meaning in all these various readings than it would be if we were dealing with just the original sentence.

  5. CharlieM: The cell uses DNA in a similar way to a concert pianist using her or his fingers to make music.

    Sorry but this is ALSO an abstraction that does not mirror reality. 😛

    Seriously Charlie, enough with the metaphors okay? They really don’t enhance anyone’s understanding.

    Now you’ve basically inverted the gene-centric relationship by saying not-DNA is in control, rather than DNA being in control.

    There is nothing “in control” of another, that is not itself causally influenced by the thing it is “controlling”, it’s all in a constant state of interaction and no particular thing is using another in a way that could not just as validly be stated with the causal relationship inverted.

    What this means is that none of these metaphors can really be said to be the one true correct way to view cellular life. They just shift around a perspective to different areas of emphasis.

    But we don’t have to relegate anything in particular to be in control to understand that evolution takes place and how it takes place.

  6. CharlieM: It doesn’t make evolution less possible, it makes unguided evolution less possible.

    If you have a sentence that can make sense by being read forwards and by being read backwards and can also make sense if certain words or phrases are extracted and rearranged, then it becomes more difficult to alter certain areas or letters and retain meaning in all these various readings than it would be if we were dealing with just the original sentence.

    What does the “meaning” metaphor relate to in this analogy?

    What justification do you have for thinking biochemical function analogizes to semantic meaning? In a massive display of irony, you seem to be focusing on genetic sequence here. In fact you’re seemingly claiming that genetic sequence is so important that mutation is almost impossible, since it’d all have to affect SOMETHING somewhere that would “break” the meaning if you changed the sequence. This is what I take you to imply.

    I actually don’t think the analogy is wrong in the sense that I certainly agree that DNA sequence affects more than just protein-coding sequence and that structure is an important component of function, but I don’t see why we should think structural biochemical function really analogizes accurately over to semantic meaning.

    I simply don’t believe in that level of functional rigidity of molecular structures (that things must be a certain way and the smallest change will break it totally, rather than just alter it’s function), in my understanding it is the other way around. Even if we take on the meaning metaphor, we know that words and sentences can be highly mutated with spelling and grammatical errors yet remain readable. Even if you change several letters in a crosswords puzzle and you can usually still read it, even thoug those “mutations” now affect several words at the same time.

    Regardless, structures are actually extremely malleable and highly tolerant to change, and rather than become straight up nonfunctional (totally lose meaning, to use the analogy), they just change into other functions instead (change meaning).

    What this implies is that the structural space contains much, much more function, than the word-letter-space of semantics in some particular language, contain meaning. Why should I abandon this view? What do you know about structure-function relationships that imply it is as rigid as you imagine?

    And perhaps more importantly, can you put numbers on it? Population geneticists deal pretty competently with the one or two-dimensionality of genetic sequences and the accumulations of changes within them over generations. Do you have any math that show a higher-dimensional space to be less amenable to a random mutations and selection heuristic? What is the “mutation rate” in the higher dimensional space? If nucleotide sequence alone has a pr base substitution rate of 10^-8, what is the the analogous rate of change of non-genetic structures? Can the cytosol “mutate” too? Can we quantify it?

  7. The basic difference between ID and science is that science treats ignorance as opportunity, and ID treats ignorance as gold to be hoarded.

    Which is why science seeks out gaps as invitations for research, and ID seeks out gaps as god.

  8. phoodoo:

    Is there some reason you wouldn’t expect that based on evolutionary theory? It makes sense that DNA repair of more essential sections of the genome would be selected for more strongly than repair of nonessential sections.

    The DNA repair is selected for?

    Anything that increases the fitness of the phenotype should be subject to positive selection.

    So you mean some individuals have bodies that had used DNA repair for nonessential sections of DNA (now we had to say bodies, because we can’t say had a genome which repaired its genome, right? Its a new mystery where this ability is being stored.)

    That’s very confused.

    but they reproduced less than those that had bodies which had DNA repair that repaired what was useful to repair.

    I haven’t read the original paper, so I’m just basing my response on what you provided. Repairing essential sections of the genome could increase fitness and hence be selected for when the capability is present. Repairing non-essential sections of the genome doesn’t increase fitness, so that capability would not be subject to selection. The latter may have a cost that would cause it to be selected against.

    These expectations are obvious to anyone with even a very basic understanding of evolution. Why are you surprised by them?

    So every once in a while we get bodies which repair genomes anywhere, we also get bodies which don’t repair anywhere, and we also get bodies which repair their entire genome, but none of those other options fare as well in the reproducing arena as the bodies which repair their genomes “just right!” and so those are the ones that drift throughout the population.

    “Drift” isn’t the right term but other than that you’ve described a scenario in which natural selection can operate.

    This natural selection gets more amazing every day! Or actually its not that natural selection is amazing, its that there are infinite universes, so everything is possible in some universe, we just happen to be in the one where the really, really, really incredible happens.

    And you’re backed to being confused.

  9. Rumraket:

    CharlieM: Some portions of the genome that are considered of no importance due to the fact that their sequences are seen to have no meaningful conservation may in fact actually possess structural conservation.

    They may, but DO they? Why to they vary so much between even closely related and pretty much identical species? Why can one species of water-lice, pretty much morphologically and behaviorally identical to another species of water-lice, get by with ONE TENTH the amount of DNA of it’s cousin?

    I would say this is more of a conundrum for those who follow the conventional explanation of evolution. The close similarity between human and chimp genomes are said to be what would be expected from the standard account of evolution. So is the vast difference between these water louse genomes also something that we would expect? If that is the case then evolutionary theory predicts similar genotypes to produce similar phenotypes but then again it predicts that different genotypes can produce similar phenotypes.

    And in many cases the same genotype produces two extremely different creatures, as in the case of the caterpillar and the butterfly. This is possible because the same genome is utilised in different ways.

  10. Rumraket: Yes, of course, evolution can’t peer into the future, it can only adapt living organisms to their current circumstances. This isn’t an argument against the possibility of evolution at all.

    Yet it has produced creatures which can peer into the future and the past and be aware of doing so. Like water flowing downhill the easiest path for evolution would have been for creatures to differentiate but remain at the very successful bacterial like existence. It takes an inconceivable amount of organisation to produce a human.

  11. CharlieM: The cell uses DNA in a similar way to a concert pianist using her or his fingers to make music.

    …and cancer happens when cells start playing christian metal

  12. CharlieM: The close similarity between human and chimp genomes are said to be what would be expected from the standard account of evolution. So is the vast difference between these water louse genomes also something that we would expect?

    Ugh. All that junk DNA talk went right over your head.

  13. Rumraket: What determines the structure and shape of DNA? That’s right, sequence.

    How does the sequence manage to pack itself and the associated molecules into the nucleus. This is the equivalent of packing 20 odd miles of thin string into a tennis ball in an extremely organised way?

  14. petrushka:
    The basic difference between ID and science is that science treats ignorance as opportunity, and ID treats ignorance as gold to be hoarded.

    Which is why science seeks out gaps as invitations for research, and ID seeks out gaps as god.

    LoL! Evolutionism relies on ignorance for knowledge refutes all of its claims. Unlike evolutionism ID makes scientifically testable claims. And by petrushka’s “logic” archaeology is just a gap venture.

  15. Rumraket: What determines the structure and shape of DNA? That’s right, sequence.

    Reference please. What we know of DNA is that it doesn’t matter what the sequence is, the shape will remain the same.

  16. Allan Miller,

    The cells and everything in them are manufactured from sequences held in DNA – including DNA itself.

    Too bad there isn’t any science to back that up. But we know your position demands that to be true. DNA cannot do anything without preexisting proteins so that would be a problem for Allan’s position.

  17. Frankie: Reference please. What we know of DNA is that it doesn’t matter what the sequence is, the shape will remain the same.

    What you (plural? WTF?) may or may not know about DNA is irrelevant. People have been studying the effect of sequence on DNA structure for decades.
    Ironically for colewd’s citation of DNAse-I hypersensitive sites as “functional”, there’s a ton of (related) literature on the sequence-specificity of DNAse-I; one of the reasons scientists poo-poo ENCODE’s defining such sites as functional.

  18. CharlieM: I would say this is more of a conundrum for those who follow the conventional explanation of evolution. The close similarity between human and chimp genomes are said to be what would be expected from the standard account of evolution.

    That doesn’t make sense. The close similarity between human and chimp, and the slightly lesser similarity to gorilla, and lesser still to orangutan and so on and so forth, is what implies common descent.

    You only expect the genetics to be similar if the morphology is similar AND if evolution is true and they share common descent.

    The most morphologically similar species should also be the most genetically similar species. Notice how this is a comparative measure, not an absolute one. It doesn’t say that an organism that is “10% morphologically similar” should also be “10% genetically similar”. It just means that those most similar on one measure, should also be most similar using another independent measure, if evolution is true and they share common descent.

    CharlieM: So is the vast difference between these water louse genomes also something that we would expect?

    We are talking about variations in total genome size, not variations in genetic sequences, or number of chromosomes, or where on the chromosomes their genes are located or whatever. Genome size only.

    That’s the point. If all this extra non-coding DNA has important organismal functions, as you seem to imply (I take it you were arguing against junk-DNA), then how come one species can get by with almost none, and another practically identical one, needs ten times as much of it?

    This is The Onion Test just stated using other species as an example.

    CharlieM: If that is the case then evolutionary theory predicts similar genotypes to produce similar phenotypes but then again it predicts that different genotypes can produce similar phenotypes.

    It doesn’t predict genomes should be constrained to the same size, because the actual explanation for (as in the mechanism that results in) the size differences, is different and independent from the explanation (the mechanism responsible) for the sequence similarities.

    The huge size differences are primarily due to stochastic variations in transposable element proliferations since the time of the split. Whereas the degree of sequence similarity in individual genes is proportional to how many mutations have crept in since the splitting event.

    Initially following speciation, the two species might be practically idential in terms of morphology, genome size, and genetic sequence. But then as generations pass, mutations creep in, leading to sequence divergence. Simultaneously, there is also transposable element activity, but it is much more variable than the average mutation rate. So you can have lots and lots of activity by transposable elements in one lineage, leading to a bloating of the genome due to repeated insertions of large amounts of non-coding DNA (which in this case really would amount to junk-DNA), while in the other lineage very little happens on the transposable element front. And yes the difference there is really just due to chance.

    Long story short:
    Sequence similarity =/= genome size.
    The two do not correlate (within certain limits of course, there IS a time component to genome size variations, your genome doesn’t amplify by a factor of ten from one generation to the next).

  19. Frankie: Reference please. What we know of DNA is that it doesn’t matter what the sequence is, the shape will remain the same.

    You should read the paper Charlie linked on the previous page.

    We are not talking about a nonexistence of the double helix here caused by sequence, the double helix will always be there, or it is at least independent of sequence. A DNA double-strand entirely of A’s base-pairing with T’s will form a double helix, and so will a totally random sequence of A, T, G and C. This is not in dispute.

    Rather, we are talking about minor variations in the shape of the turns and the backbone of the double helix, those variations are among some of the properties that make it possible for DNA-binding proteins to find and bind particular parts of double-stranded DNA, because the bases have certain functional groups sticking out of them, causing minor structure variations in the DNA strand, which the proteins can detect.

  20. CharlieM: How does the sequence manage to pack itself and the associated molecules into the nucleus. This is the equivalent of packing 20 odd miles of thin string into a tennis ball in an extremely organised way?

    I don’t understand the relevance of this question to what we are discussing. Did you want to make some point with it?

    Taken literally, DNA-strands usually don’t do anything to themselves (I say usually because, deoxyRibozymes have been found, as in strands of DNA that act as catalysts just like protein enzymes and RNA ribozymes).

    But besides these, DNA pretty much just sit there if left alone in a static environment. Proteins act on the DNA to compact it so it can fit in the nucleus.

    Is there some point you wanted to make by this factoid?

  21. Did the ignore function get removed? I like interacting with intelligent people. Frankie, not so much.

  22. CharlieM: Yet it has produced creatures which can peer into the future and the past and be aware of doing so. Like water flowing downhill the easiest path for evolution would have been for creatures to differentiate but remain at the very successful bacterial like existence. It takes an inconceivable amount of organisation to produce a human.

    Yes, it’s amazing what evolution has done in those 4 billion years of time.

  23. RumraketCharlieM: Like water flowing downhill the easiest path for evolution would have been for creatures to differentiate but remain at the very successful bacterial like existence.

    That must be why nearly all living things are still at that level, including most of the cells in the human body.

    And why most of the protein coding genes that exist were invented at that level.

  24. CharlieM: Yet it has produced creatures which can peer into the future and the past and be aware of doing so. Like water flowing downhill the easiest path for evolution would have been for creatures to differentiate but remain at the very successful bacterial like existence. It takes an inconceivable amount of organisation to produce a human.

    Yes, aren’t we humans amazing? But bacteria are pretty amazing, too. And they are likely to be here long after humans are extinct. Bacteria-like lifeforms had the planet all to themselves for perhaps 2 billion years before anything more complex (i.e., eukaryotes) arose. Sometimes flowing water does splash a bit uphill. One splash may be all that is needed (by life forms, not water) to acquire a new layer of complexity and begin to diversify at the new level. Eukaryotes may have been around for another billion years before truly multi-cellular organisms appeared. Single-celled eukaryotes continue to abound and flourish to this day. Humans and other macroscopic organisms, considered on life’s full time scale, appear to be something of an afterthought. To a fair approximation, evolution still favors bacteria and other unicellular organisms.

  25. Rumraket: Yes, it’s amazing what evolution has done in those 4 billion years of time.

    Unguided evolution is impotent and couldn’t do anything but cause deterioration and disease.

  26. Rumraket,

    The close similarity between human and chimp, and the slightly lesser similarity to gorilla, and lesser still to orangutan and so on and so forth, is what implies common descent.

    The close similarity between human and chimp, and the slightly lesser similarity to gorilla, and lesser still to orangutan and so on and so forth, is what implies common DESIGN.

    You only expect the genetics to be similar if the morphology is similar AND if evolution is true and they share common descent.

    You only expect the genetics to be similar if the morphology is similar AND if ID evolution is true and they share common DESIGN

  27. Rumraket:

    Allan Miller:
    It does seem weird to inist that there are supposed 3D DNA structures that are vital to the unrolling of specific phenotypes yet they cannot suffer deleterious mutations to primary sequence.

    Yeah that simply doesn’t make sense. 3D DNA structure has sequence redundancy to some extent (in the same way the genetic code has 3rd position redundancy), since some sequences of bases, despite not being identical, still produce similar shapes. But that doesn’t mean it is sequence independent. It clearly isn’t, it take certain sequences to produce certain shapes.

    Nowhere have I said that sequence isn’t important in producing proteins.

    But what we have to remember is that, generally speaking, all the multitude of cell types in our bodies contain the same genome sequence. The differences whether it is a neuron or a red blood cell result not from the sequence but by the way that this sequence is manipulated.

  28. CharlieM: The differences whether it is a neuron or a red blood cell result not from the sequence but by the way that this sequence is manipulated.

    And this startling fact was discovered when?

  29. petrushka,

    Its not the fact that is relevant, it is the questions that it should stimulate in enquiring minds. An unthinking response IMO would be, “Yes, we all know that, so what?”

  30. CharlieM: Its not the fact that is relevant, it is the questions that it should stimulate in enquiring minds. An unthinking response IMO would be, “Yes, we all know that, so what?”

    Ever hear of evo-devo?

    Do you really suppose the question of how cells differentiate has not been studied?

  31. Frankie: Unguided evolution is impotent and couldn’t do anything but cause deterioration and disease.

    Seems to have worked fine in the LTEE.

  32. Rumraket: Seems to have worked fine in the LTEE.

    See the link I just posted in Sandbox.

    Selection is guidance. Purifying selection prevents detrimental mutations from fixing.

    There is such a thing as having a reasonable idea that is simply demonstrated to be wrong.

  33. Frankie: Rumraket, The close similarity between human and chimp, and the slightly lesser similarity to gorilla, and lesser still to orangutan and so on and so forth, is what implies common DESIGN.

    You only expect the genetics to be similar if the morphology is similar AND if ID evolution is true and they share common DESIGN

    I’ve dealt with this falsehood before at length. Here it is, all over again (read it all the way through, all valid objections I’ve so far heard of are refuted):

    On intelligent design you expect NOTHING IN PARTICULAR. All patterns are possible, but no pattern is any more expected than another unless you already know something about what goes on in the mind of the designer(do ID proponents happen to know that their intelligent designer WANTS to design nesting hierarchies? No they don’t, it’s just an ad-hoc rationalization).

    All patterns are after-the-fact compatible with design, but none of them are exclusively or statistically predicted to appear over others when the designer and its methods are unknown.
    Yes, design CAN explain all the same observations as evolution by common descent. But only in an empty and ad-hoc fashion that lacks explanatory power. (As in, it doesn’t actually explain or predict why we see what we see).“That’s just the way the creative designer wanted to make it”. There is no WHY or HOW in the design-rationalization. It is nothing BUT a rationalization invented after the discovery of nesting patterns of similarities.

    Furthermore, why do human beings (the only intelligent designer we know of empirically) use “common design”? Mostly to save time and resources. Human beings copy previous designs because it is simply faster to do so when they need to make something that works. Nuts and bolts are reused because they work fine as they are, no need to change them. They are standardized; the factory has no good reason to invent new, sliiiiightly different ones every time (the same way we see, for example, regulatory regions mutate over time and phylogenies being constructible there from). Wheels are good for vehicles, easy to copy the basic pattern and save time, instead of having to re-invent a new method of locomotion every time. And build an entirely new factory to produce them.

    But, life wasn’t designed by humans, so we can’t use analogies to anthropomorphic tendencies with respect to design. The kind of designer most ID proponents think designed life is an omnipotent supernatural designer, unconstrained by a faulty or mediocre imagination, unconstrained by a lack of time, unconstrained by resources, unconstrained by materials or anything at all. Such a designer would have absolutely no practical reasons for copying it’s designs over and over again in a derivative fashion by re-using and slightly altering items and structures from previous designs, to include in new organism that appear as evolved derivations of previous ones. None of the inferences we use to infer human design took place, are valid inferences for an unconstrained, omnipotent divine designer who does not have human concerns of practicality such as resources, lack of intelligence, imagination, creativity and time.

    So there is a colossal ambivalence at the heart of many ID proponents, who start with a conclusion that a specific and supernatural designer did the designing. This leads them into problems very quickly, for among other reasons that the nature, capacities and intentions of their designer, they assert, is unknowable, infinite and mysterious, respectively.

    But in science we work with what we got and from what we know:
    Observed designers, observed natural processes, observed manufacturing processes leaving observational evidence behind. The mechanism is understood, it makes testable predictions. It fits into already well-established frameworks of science from other fields: Physics, chemistry etc.(And in the case of human designs, human psychology, human inventions and technology and human culture, basically anthropology). We can then form hypotheses and look for the results of the mechanism and either confirm or falsify the hypothesis.

    Now comes “ID”. Do it have a mechanism? Nope.

    What did it make? Depending on who you ask, all living organisms as-is, or occasionally it just dropped in to magically instantiate specific mutations at various points in the history of life, or zap a flagellum into existence.

    Does their designer leave a signature, product description or trademark behind?(Stainless Steel, Goodyear, Firelli, Made in Taiwan, Nike, Microsoft, Coca Cola, nVIDIA… ) Nope.

    Does it use tools? Nope (or no idea, things magically appear with no process of fabrication and construction).

    When did it operate? No idea, millions and billions of years ago and now it’s suddenly stopped entirely no new creations take place. No creation has ever been observed. No macro-creation, not even micro-creation. Simply put, we observe absolutely nothing at all that looks like it is being instantly created with divine magic.

    Do they draw analogies to human manufacturing processes? Well, they sometimes say that the designer re-uses old designs. What reasons do they have to expect their designer to do this? Since they don’t know the designers mind or intentions (they keep saying this to secular audiences), then they must be getting their idea from having seen human beings design things.

    Ok, let’s just run with that. Let’s try the “accepts common descent and some degree of evolution but occasionally dropping in to make specific mutations happen by screwing with atoms at the quantum-level” (theistic evolution ala Kenneth Miller’s ideas). What testable predictions does this make? It should look exactly like evolution happened.
    Just like evolution could have created all of life through mutations, drift and selection, with all the minor quirks and oddities being the result of incomplete lineage sorting, convergent evolution, drift, horizontal gene transfer and so on,
    all expected to happen but never statistically significantly deviate from the main pattern, so does theistic evolution become observationally indistinguishable from naturalistic evolution.

    In other words, an unobserved designer operating in the deep geological past, on a global scale, who has the ability to make specific mutations happen inside living organisms, is in competition with the observed fact that evolution happens naturally:

    A) Mutations observationally happen, and we have no good reason to think they wouldn’t in the past too.
    B) Those mutations affect the morphology and the physiology of the host organisms, and we have no good reason to think they wouldn’t in the past too.
    C) The phenotypical and morphological effects of those mutations affect the reproductive success of the carrier organism, and we have no good reason to think it wouldn’t in the past too.
    So simply put, drift and selection observationally happens, and we have no good reason to think it wouldn’t in the past too.
    E) Environments observationally change, and we have good reason to think they did in the past too (all of geology and the Earth-sciences testify to this).
    F) Horizontal gene transfer observationally happens, and we have no good reason to think it wouldn’t in the past too.
    G) Incomplete lineage sorting observationally happens, and we have no good reason to think it wouldn’t in the past too.
    H) Convergent evolution observationally happens, and we have no good reason to think it wouldn’t in the past too.

    Which is the simplest, most parsimonious explanation of the observed shared derived characteristics in extant life, then? The observed one that doesn’t require us to erect uneconomical unobserved entities: Evolution.

    Ok, fuck that then. Moving on to the “all life made as-is” (space-aliens with super duper technology-ID-creationism).

    Well, we should expect to find similarities between some species(still re-using old designs).
    Ok, we find that. But we have at least two hypotheses that predict this same feature, so can we distinguish between them? Well, evolution predicts congruent nesting hierarchies in morphology, anatomical features and genetics.

    But designers have been known to design nested hierarchies too.

    Sure, but again the reasoning is arrived at ad-hoc. Mere re-using of old designs should not in itself yield highly congruent multiple nesting hierarchies into which all of life fits to an extremely high degree of confidence.

    No, but it still could have been designed.

    Yes! But why would we believe it was beyond the mere possibility? What grounds are there to believe that this is what happened? What are the odds that, even if you as a “designer” sits down and thinks “I’m going to reuse some of my older designs”, inadvertently produces a nested hierarchy, into which every species on the planet fits, both genetically, morphologically (and chronologically in the fossil record)? And why would you do it deliberately? What are the odds that your designer sat down and designed this specific pattern?

    Does the observed nested hierarchy even make sense with respect to known, human designers method of design and manufacture?

    Let’s see:
    A look into the mind of the designer of the nested hierarchy:
    “Common design – common designer” (by deliberately forming sets within sets within sets).

    Here’s a small insight into it’s train of thought (courteously trying to give ourselves reason to entertain the design hypothesis by drawing from the only intelligent designer we know of – Homo Sapiens):

    Oh, I’m going to design a bacterium with a genome like this (the first genome!).
    AAAGGGCCCTTTAAGGCCTTAGCT

    Oh, I want to design another organism, re-using some of my bacteria designs(the “common designs”-argument), so it looks like this new organism genetically and morphologically mostly derives from the first one.
    AAAGGGCCCTTTAAGGCCTTAGCA

    Oh, I’m going to design a 3rd organism, this time re-using designs from the 2nd organism, so it looks like it mostly derives from the 2nd one.
    AAAGGGCCCTTTAAGGCCTTACCA

    Oh, I’m going to design a 4th organisms, this time re-using designs from the 3rd, so it looks like it mostly derives from the 4th one.
    AAAGGGCCCTTTAAGGCCTAACCA

    Oh, I’m also, intermittently, going to go back and re-tweak my previous creations, so that it looks like they each independently changed since I first created them.
    1st Organism: TAAGGGCCCTTTAAGGCCTTAGCT
    2nd Organism: ATAGGGCCCTTTAAGGCCTTACCA
    3rd Organism: AATGGGCCCTTTAAGGCCTTACCA
    4th Organism: AAAGGGCCCATTAAGGCCTAACCA

    Not only am I going to do this, mysterious designer as I am, I’m going to do it in such a way that the degree of change it looks like they underwent, is directly proportional to how old their time of divergence will look like if calculated from number of nucleotide substitutions(and estimated from the fossil record). Haha, take that – future humans whom I’m going to create at some point too!

    Anyway, back to business, creating a 5th organism, this time re-using designs from the 4th, so that it looks like it mostly derives from the 4th one.
    ACAGGGCCCATTAAGGCCTAACGA

    Oh, I just got a brilliant idea! I’m going to go back to the first organism I designed, and then derive a whole new “branch” from it. But I’m not going to be deriving this branch from the original genome I first created, no, I’m going to change it slightly so it looks like that first genome evolved for a time before this new “divergence” happened, THEN I’m going to make the new “branch”.
    1) TTAGCGCCCTTTAAGGCCTTAGCT
    1a) TTAGCGCCCTTAAAGGCCTTAGCT (independently derived from 1)
    1b) TTAGCGCCCTTTATGGCCTTAGCT (independently derived from 1 also)
    There, perfect!

    Oh, I just got another brilliant idea. In addition to the intermittent return to tweaking the genomes of previously designed organisms, I’m going to do the exact same I just did to the first lineage: Intermittently derive more independent branches off of each of the 2nd, 3rd, 4th, 5th (and so on) “lineages” I created, using the same hilariously illogical method I just used to create a branch off of the 1st one. Brilliant!

    And I’m going to do this for millions and millions and millions of species. And to top it all off I’m going to kill billions of them in intermittent extinction events, burying them in the millions in seemingly temporal order matching with morphological and genetic sequence, so that it just so happens to look like they left incrementally changed descendants over a very long timescale.

    I wonder what the odds of me creating and designing life, exactly using this method is? I wonder if it even makes sense to postulate that anything would do “design” like this? Hmmm.

    Does this make sense to postulate? No, it doesn’t. No mentally healthy intelligent designer would operate like this and produce a nested hierarchy indistinguishable from the one produced by the evolutionary process.

    I submit that if you can convince yourself that your designer operated like this, then you’re either insane, deluded, or infinitely gullible. Regardless, it would be irrational to believe it.

  34. petrushka: See the link I just posted in Sandbox.

    Selection is guidance. Purifying selection prevents detrimental mutations from fixing.

    There is such a thing as having a reasonable idea that is simply demonstrated to be wrong.

    Well that would probably be Frankie’s response, that selection is a form of guidance because a human being once upon a time touched the flask the bacteria are growing in.
    That means there’s something nebulous wrong with the whole thing. The human being is sending “guidance beams” with his touching of the flask into the bacteria, preventing them from going extinct. Or something.
    It’s a variation of the same response Gpuccio gave to the Keefe and Szostak paper in a previous thread, somehow the fact that human beings set up the experiment invalidates the result. They can’t say how, but a there was a scientist there in the room at least part of the time when it evolved, so, there! It’s now intelligent design. Praise the LORD!

  35. Rumraket,

    On intelligent design you expect NOTHING IN PARTICULAR.

    That is your opinion. However given a Common Design there is a pattern we would expect.

    All patterns are after-the-fact compatible with design

    Evolutionism is all after-the-fact. It doesn’t make any useful predictions

    Yes, design CAN explain all the same observations as evolution by common descent.

    Evolution by common descent is useless and meaningless. Unguided evolution just destroys and cannot produce new body plans.

    You don’t have a mechanism capable of producing the genetic code. You don’t have a mechanism capable of producing ATP synthase. You can’t even get to biological reproduction.

    Look you can attack ID all you want but that is never going to help you find supporting evidence for your position. By your logic there was only ever one book written and all others came from that via copying errors that were kept.

    I submit that if you can convince yourself that your designer mimic operated like this, then you’re either insane, deluded, or infinitely gullible. Regardless, it would be irrational to believe it.

  36. petrushka: See the link I just posted in Sandbox.

    Selection is guidance. Purifying selection prevents detrimental mutations from fixing.

    There is such a thing as having a reasonable idea that is simply demonstrated to be wrong.

    Natural selection is elimination and is blind and mindless. It doesn’t offer any guidance. Only the very desperate use that tactic and it always fails.

  37. Rumraket: Seems to have worked fine in the LTEE.

    LoL! Only if you assume it was unguided evolution that did it. Too bad it happens all of the time*, meaning most likely it was due to a built-in response

    * other experiments with E coli have also produced the ability to utilize citrate in an aerobic environment

  38. petrushka: Everhear of evo-devo?

    Do you really suppose the question of how cells differentiate has not been studied?

    evo-devo has been a total bust at explaining body plans and how they could have evolved.

  39. Frankie: That is your opinion.

    No actually it’s a pretty well developed argument, based on logic and, well, the fact that I myself am a designer and know something about history and how designers operate.

    However given a Common Design there is a pattern we would expect.

    No, you actually wouldn’t, that’s the point. Read the entire post. All the way through. For comprehension.

  40. Frankie:
    Rumraket,

    That is your opinion. However given a Common Design there is a pattern we would expect.

    Evolutionism is all after-the-fact. It doesn’t make any useful predictions

    Evolution by common descent is useless and meaningless. Unguided evolution just destroys and cannot produce new body plans.

    You don’t have a mechanism capable of producing the genetic code. …

    Right, okay Frankie. Immediately following your opening sentence where you accuse me of merely stating an opinion, you go on to do exactly that. IDcreationists and irony, it seems you can’t have the former without the latter.

    The important difference between my post and yours is that I develop arguments to support my assertions. You just assert.

    Rather than actually deal with any of the arguments I make, you basically make a post that just asserts the opposite conclusion. Nothing is stated that supports it, it’s just one-liner blanket denials. Well done, I can see how a dispassionate 3rd party observer would score this one for Frankie-ID.

    I submit, you have me beat.

  41. Frankie: Unguided evolution is impotent and couldn’t do anything but cause deterioration and disease.

    And by “…cause deterioration and disease” may we assume you mean the evolution of successful organisms or processes? Or hadn’t you considered what “deterioration and disease” looks like from a position other than human centric.

Leave a Reply