Phylogeny – the Bigger Picture

During recent discussions on phylogeny, we saw a distinct failure to communicate, probably felt by both sides. The ‘evos’ attempted to consider the role of molecular data in determining relationship. Given that an obvious cause of common sequence is common descent, due to the significant but not perfect fidelity of the DNA replication process, the phylogenetic inference is that sequence similarity is indicative of common descent. This, critics feel, is a circular argument.

In this, they may be following Jonathan Wells in Icons of Evolution. His criticism is that “homology is inferred from common ancestry, then turned around and used as evidence for common ancestry”. Yet in molecular genetics, the term ‘homology’ tends to be used to indicate sequence similarity alone, not a descent relationship. DNA probes and separate-strand annealing rely upon ‘high homology’, meaning only complementary sequence. The similarity is an observation, not an inference. If one had two sequences, XXXXXXXY and XXXXXXXZ, they certainly aren’t inferred to be similar: they really are similar. The retention of similarity (with variations) in a line of descent is also an observation. It is not clear to me where the circularity comes in in putting those two observations together and inferring that sequence similarity is supportive of common descent. Particularly when other sites are brought in to the analysis. Each site verifies the assumption for the other(s); Creationists on the other hand lump the whole into a composite sequence, and expect ‘independence’ to come from something other than sequence identity. You can’t verify genes using genes, or something.

Well, if the argument is circular, we must apply that razor to within-species comparisons as well – paternity testing, forensics, molecular genealogy and ethnic investigations must all be based upon circular reasoning too. Which I suspect no-one would try and argue in court. Broadening this out to between-gene-pool sequence similarity, among species that are even termed ‘closely related’, we presumably don’t have a major problem with sequence being commonly derived from a common ancestor there either. So the question is: as one goes ‘upwards’ in the Linnaean classification system, where does the circularity arise, if it is not there throughout? The differences identified between higher taxa are inevitably greater than those at lower, as one would expect from the same process of descent with modification that explains similarity among relatives, extended in time. As time goes on, the similarities erode and the differences increase. But there is no boundary detectable, no clear transition at which ‘circular reasoning’ comes in, nor where there is an abrupt difference as would be expected from separate origins. Differences remain a matter of degree, albeit confounded by rare events and inevitable statistical artefacts.

The Creationist alternative for sequence similarity is ‘Common Design’. I confess I can never make any sense of this. At what point does Common Descent stop and Common Design take over? In a process whereby a Designer generated in initial version of a sequence, and then allowed nature to take its course, the similarities between subsequent lineages would actually be due to Common Descent, not the initial Design.

OK, we might propose a Designer making separate taxa. The similarities in sequences between any two such taxa could be termed Common Design. But members of Taxon A and Taxon B are still commonly descended from that point on, from the moment of creation. So you can never separate out Common Design completely from Common Descent. In any process where similarities were initiated by Common Design, residual within-taxon similarities still indicate Common Descent from those points. The exact same kind of data has two completely different explanations across that assumed boundary, which is extravagant and inconsistent. The boundary is not a real boundary in the data.

If we follow the differences in Taxons A and B back, attempting to reverse out evolutionary history, we get to a point where the ‘ur-sequences’ exhibit a high degree of sequence similarity. Something which, if we observed it today, would strongly support a genetic relationship. So what would persuade us that, at that point in history, the relationship was not, in fact, genetic?

Common Design is sometimes invoked as ‘like creatures need like DNA’. But if we envisage the Design occurring at a high enough taxonomic level, we are saying that some very unalike ‘creatures’ had like DNA, at the moment they were … created. They only have unalike DNA now, after a few million years of separate change.

Further, none of this helps explain genetic similarities at loci that have little to do with phenotypic difference. One of the principal markers used in paternity testing are SINEs – a kind of transposon. Intergenic examples have no apparent phenotypic effect, and vary in humans (obviously, or they’d be no use). But there are also SINE inserts that are held in common between humans and chimps, others that are diagnostic at still higher taxonomic levels. They can’t all be essential to the form of the members of the clade they are restricted to – can they?

I’ve taken a somewhat circuitous route to my point, and the reason for the title. Consider the following not-very-treelike tree.

i-5feb4cbd88250bf87fba504db8ff9f8c-Eukaryote_tree

It represents the result of extensive phylogenetic analysis of the entire eukaryote clade. Reminiscent of those ‘you are here’ pictures of the Milky Way, ‘animals’ are all stuffed in the red box at bottom right. That’s everything: vertebrates, insects, sponges, nematodes … Fungi are just above, and land plants, seaweeds and Volvocales at about 11 o’clock. That’s pretty much it for multicellular life. The tree overwhelmingly consists of unicellular eukaryotes of bewildering diversity – what used to be called protists, and still are when we aren’t being cladistically rigorous. Never mind beetles, thats what the designer has an inordinate fondness for! If we had no place on this tree, I suspect people would have no problem with it, or the methods used to infer it. Of course we notice the multicellular life more than anything else. They’re bigger. It’s us, it’s our pets, food, materials and enemies. But most of the tree is minute, and does not indulge colonial clumping, amendments of which cause the ‘mechanical impossibility’ arguments ranged against phylogeny.

The discussions involved in resolving and testing these ‘protistan’ branches are surprisingly heated. It’s not just a question of assuming a relationship; the relationships are teased out of the data. If there were no relationship, that too would be apparent from the data. So where, in the progression to the interior of this diagram, and trying not to be bamboozled by the contents of that little red box, does circular reasoning come into it? Likewise, where does Common Design take over from Common Descent as the cause of similarity?

415 thoughts on “Phylogeny – the Bigger Picture”

  1. GlenDavidson

    It’s common design, unless it isn’t. Why do we have similarities with cephalopods? Because of common design. Well, why isn’t the cephalopod eye like ours (beyond physical necessity, of course)? The Designer decided to make it differently. Why don’t cephalopods have myelinated nerves (and so have some large, easily-studied nerves)? Well again, that’s what the Designer wanted.

    Or, of course, one might note that if we split off from cephalopods early (before myelinization and eyes with lenses), common descent would dictate certain similarities without these extending to more derived features, such as complex eyes and improved nerve operation.

    One is an explanation (backed up by paleontology), the other, ad hoc rationalization.

    Glen Davidson

  2. John HarshmanJohn Harshman

    Something I wrote a few years ago, when Icons of Evolution first came out, is worth posting here. Jonathan Wells poses 10 questions for students to ask their teachers. This is an answer to one of them.

    Wells’ Question 3: Homology.

    “Why do textbooks define homology as similarity due
    to common ancestry, then claim that it is evidence for common
    ancestry — a circular argument masquerading as scientific
    evidence?”

    Answer:

    This question stems from confusion on Wells’ part between how something is defined and how it is recognized, which are two quite different things. Homology is indeed defined as similarity due to common ancestry. But we don’t just label any similarity a homology and call it evidence for common ancestry. That would indeed be circular. What we really do is quite different. Similarity between the characteristics of two organisms is an observation. If the similarity is sufficiently detailed (“both are big” or “both are green” won’t do) we consider it a candidate for homology.

    Homologies can be tested to some degree by predicting that the characters will be similar in ways we haven’t yet checked. For example, if we propose that similar-looking bones in two animals are homologous, we might predict that they would arise from similar precursors in the embryo, have similar spatial relationships to other bones in the organism, and have their development influenced by similar genes. And this is commonly the case.

    But the main way of testing candidate homologies is by congruence with other proposed homologies. By congruence we mean that the two characters can plausibly belong to the same history. If the history of life looks like a tree, with species related by branching from common ancestors, then all true homologies should fit that tree; that is, each homology should arise once and only once on the tree. If a large number of functionally and genetically independent candidate homologies fit the same evolutionary tree, we can infer both that the candidates really are homologies and that the tree reflects a real evolutionary history.

    And in fact that’s what we commonly find. Mammals, for example, are inferred to descend from a common ancestor because they all have hair, mammary glands, and other more obscure characteristics like seven neckbones and three earbones. All these characteristics go together: mammals have all of them and no other animals have any of them. Further, other characters support consistent groupings within mammals, and groupings within those groupings. Within most of life, groups are organized in a very special way called a hierarchy. In a hierarchy, every group is related to every other group in one of two ways: either one group entirely contained within the other (as in a below), or they share no members at all (as in b below). No two groups can partially overlap (as in c below).

    [Sorry, you will have to imagine the graphic, as it won’t copy. a. is a pair of concentric circles; b. is a pair of non-overlapping circles; and c. is a pair of overlapping circles.]

    What we see if we try to organize species using candidate homologies is that groups organized according to different characters fit together like a and b, but not c, so we get a pattern like this:

    [This is a Venn diagram showing a set of characters diagnosing mammals and various groups within mammals, e.g. a cow and a whale with a circle around them labeled “double-pulley astragalus”.]

    Why should these and many other characters all go together in this consistent way? Evolutionary biology explains these characters as homologies, all evolved on a single tree of descent, like this:

    [This is a cladogram with the characters from the Venn diagram that you had to imagine above optimized onto the branches.]

    Wells gives no alternative explanation for such patterns, and indeed they are hard to explain in any other way than as reflections of an evolutionary history. Wells has it all wrong. Homology isn’t a circular argument, it’s a branching tree of evidence.

  3. Alan FoxAlan Fox

    John Harshman,

    Just a suggestion on the graphics, John. You can upload to the TSZ media files (a screen capture as a jpg for example) and I can add them into your comment.

  4. keithskeiths

    Alan, to John:

    Just a suggestion on the graphics, John. You can upload to the TSZ media files (a screen capture as a jpg for example) and I can add them into your comment.

    But to do that, don’t use the “Upload file” feature above the combox. That will only add a single graphic to the end of a comment.

    Instead, you’ll want to:

    1. Mouse over “The Skeptical Zone” in the black WordPress bar at the top of your browser window.

    2. Click on “Dashboard”.

    3. Mouse over “Media” in the left sidebar and click on “Add new”.

    4. Select a file and upload it. It will then become part of the media library, and Alan will be able to add it to your comment.

  5. John HarshmanJohn Harshman

    Alan Fox:
    John Harshman,

    Just a suggestion on the graphics, John. You can upload to the TSZ media files (a screen capture as a jpg for example) and I can add them into your comment.

    Just did that. Hmmm…but seeing as it’s now a single pdf, I should probably just put it at the end. But oh; the time for that has passed.

  6. phoodoo

    John Harshman,

    The big problem with all of this of course, which you conveniently ignored, is the concept of convergent evolution.

    If the exact same trait can arise completely independently in two different lines, how can homology be used to decide common ancestry? I mean can there be a more glaringly obvious contradiction to the entire concept than this?

    For instance, humans and koalas both have fingerprints, and they are nearly identical. Gee, I guess it must be because of common descent right!

  7. Flint

    phoodoo:
    John Harshman,

    The big problem with all of this of course, which you conveniently ignored, is the concept of convergent evolution.

    If the exact same trait can arise completely independently in two different lines, how can homology be used to decide common ancestry?I mean can there be a more glaringly obvious contradiction to the entire concept than this?

    I’m certainly not a biologist, but my understanding is that at the molecular level, the “exact same trait” never does evolve independently. At a higher functional level (such as wings), then sure, there are lots of flying critters. But their wings are not “exactly the same”.

    For instance, humans and koalas both have fingerprints, and they are nearly identical.Gee, I guess it must be because of common descent right!

    Let’s assume humans and koalas have a common ancestor. IF that ancestor had fingerprints, and IF all descendent species from that common ancestor ALL had fingerprints, then it would be highly probable this is a homology. If this is not the case, then what you have is a similarity and not a homology – that is, the superficial characteristic is almost alike, but the underlying development of it might be quite different.

  8. John HarshmanJohn Harshman

    Flint: I’m certainly not a biologist, but my understanding is that at the molecular level, the “exact same trait” never does evolve independently. At a higher functional level (such as wings), then sure, there are lots of flying critters. But their wings are not “exactly the same”.

    Let’s assume humans and koalas have a common ancestor. IF that ancestor had fingerprints, and IF all descendent species from that common ancestor ALL had fingerprints, then it would be highly probable this is a homology. If this is not the case, then what you have is a similarity and not a homology – that is, the superficial characteristic is almost alike, but the underlying development of it might be quite different.

    See, this is why I have phoodoo on “ignore”. He doesn’t read. I already explained how you distinguish homology from convergence. Now at the molecular level, or at least the level of individual nucleotides, the exact same trait does evolve multiple times. There are only four possible states, after all. But we can still distinguish homology from convergence, at least probabilistically, again based on congruence of multiple characters or fit to a tree.

  9. REW

    John Harshman: No two groups can partially overlap (as in c below).

    By overlap you mean species that are in both groups? You could only eliminate the overlap by identifying convergent traits as such. I wonder if the IDers might try to claim this as circular reasoning?

  10. REW

    John Harshman: Something I wrote a few years ago, when Icons of Evolution first came out, is worth posting here

    I’d really like to see you present this in a public debate with Wells. That would be very entertaining.

  11. John HarshmanJohn Harshman

    REW: By overlap you mean species that are in both groups? You could only eliminate the overlap by identifying convergent traits as such.I wonder if the IDers might try to claim this as circular reasoning?

    I’m sure they would. Now of course I simplified everything, and none of my characters conflicted with each other. Thus my circles represented both characters and the clades they diagnose. In the real world, there is such a thing as convergence (technically called homoplasy). We could try to eliminate it a priori, based on its lack of fit to an assumed tree, before performing a phylogenetic analysis that’s guaranteed to return the tree we had assumed. That would indeed be circular. But that isn’t what we do. We decide homoplasy a posteriori, after an analysis without any such preconceptions, based on a lack of fit to the tree that all the data give us. Homoplasy adds noise to analyses, but the majority of signals are strong enough to overcome the noise.

  12. John HarshmanJohn Harshman

    REW: I’d really like to see you present this in a public debate with Wells.That would be very entertaining.

    To paraphrase Dawkins: That would look good on his resumé; mine, not so much.

  13. stcordova

    Well, if the argument is circular, we must apply that razor to within-species comparisons as well – paternity testing, forensics, molecular genealogy and ethnic investigations must all be based upon circular reasoning too

    I don’t think that is an accurate characterization.

    No problem applying phylogeny tests when common descent is mechanically feasible and there aren’t absurd transitions (like prokaryote to eukaryote) or absurd common ancestors (like of tigers and butterflies and grass).

    You can’t conflate similarity with mechanical feasibility, which is what a lot of evolutionists do.

    There is molecular and developmental convergence like that of the sideways development of teeth in elephants and sea cows, there is convergence in penises in mammals and dragon flies. So assuming common descent explains some similarities leaves one with convergence as a matter of principle, hence applying common descent to explain some and then not all similarity is ad hoc.

    Evolutionists keep conflating and equivocating similarity arguments as some sort of proof of mechanical feasibility. That’s the circularity and non-sequiturs in reasoning.

    Well, if the argument is circular, we must apply that razor to within-species comparisons as well – paternity testing, forensics, molecular genealogy and ethnic investigations must all be based upon circular reasoning too

    You’re not characterizing the real issue. Paternity tests among humans doesn’t have the added layer of having to prove mechanical feasibility of descent. Having plants and animals descend from a common ancestor has substantially more issues than human descending from other humans. What you just said puts the difficulty of birds descending from fish on the same level as humans descending from other humans. Absurdity.

    And as I said, there are similarities of convergence that won’t go away even as a matter of principle because whatever phylogeny is built there is molecular and morphological convergence. So one is stuck with similarities that can’t be explained by universal common descent, so one is better off just dropping common descent as an assumption or rather leave it as an un answered question than pretend it’s on the level of science of other real theories like say geometric optics.

    Likewise, where does Common Design take over from Common Descent as the cause of similarity?

    For starters convergences. Next is where it is mechanically infeasible to assert a common ancestor. If we don’t know for sure, say, “we don’t know, but we believe despite concrete evidence.” Why is that so hard? I don’t see much to be gained scientifically by being so insistent. Being insistent is more of a religious thing. Religions ok, but let’s not pretend it’s science when really it’s more of presumption and faith pretending to be science.

  14. phoodoo

    John Harshman,

    And this is why, ignore me or not, I am not going to let you off the hook with your bullshit explanations, just because they are wordy.

    To Wit: Why should there be convergence at all!! Who, with any kind of honest intellectual skepticism at all, would believe that a theory that says, we start with nothing, we accidentally get copying which is often erratic and error prone, and sometimes these accidents pile-up one on top of another to (lacking any design or plan) form complex organized, extremely intricate systems. And sometimes this completely unplanned, unorganized meaningless accidents, results in the exact same thing, multiple times!!

    Give me a fucking break, you pseudo skeptics! Yea, yea, fingerprints, eyes, jaws with teeth for eating…right, obviously with enough errors this is going to happen again and again. How bad does one’s cognitive bias have to be to believe that?

    But go ahead and also put guys like Jonathon Wells on ignore also John, because yea, you really like scrutiny don’t you.

  15. phoodoo

    John Harshman,

    You have a resume???

    I think when Dawkins said this, he surely was referring to a resume others made of him, not one he made of himself.

  16. John HarshmanJohn Harshman

    stcordova,

    All in all, much too vague to be worth much as a reply. You toss around “mechanically infeasible” as if anyone knows what you mean. What, for example, is “mechanically infeasible” about a common ancestor of tigers and butterflies, or tigers and grass?

    What is this convergence of elephants and sea cows or mammas and dragonflies? Why can you conceive of no way of distinguishing convergence from homology other than making it up to fit a preconceived story? Do you actually believe that’s how it’s really done?

    Sorry, probably talking to myself again.

  17. Tom EnglishTom English

    A general remark, as I’m incompetent to remark specifically: The strength of evolutionary theory has always been that dissimilar lines of evidence call for similar explanations. Creationists who bother with the data invariably play divide and conquer. They isolate just as small an area of investigation as they can, do their utmost to give the impression that evolutionary theory hangs in the balance, and lay on with rhetoric designed to impress the rubes. Of course you “evos” should set them straight on technical details. But I think you should “go off-topic” more often than you do, and describe in simple terms how the results of the particular area under discussion jibe with those in other areas.

  18. phoodoo

    Tom English: They isolate just as small an area of investigation as they can

    Like convergent evolution?

    Is that a small, pesky little detail?

  19. Joe FelsensteinJoe Felsenstein

    Allan and John, thanks for an excellent explanation. And yes, John has a resume of active and high-quality work in systematics. I have a resume too (my CV) which is easily findable online. I wrote the main book on phylogeny methods. In it I gave due, and respectful, considerations to John Harshman’s excellent 1994 methodology paper, which dispelled a myth about bootstrap methods.

    Another way of saying the same thing as John is to say that phylogenies (evolutionary trees) that are based on different parts of the genome, such as different loci, tend to reinforce each other. You can check this yourself on websites such as OrthoMam which allow you to see data from many genes and show you the phylogenies inferred from each gene. Groups such as the clade of human and chimp show up again and again. (I just checked 10 genes there, and in all 10 of them the tree shows Human, Chimp, and Gorilla as a clade).

    It was this same phenomenon, using data from different suites of morphological characters, that convinced many biologists in the mid-1800s that evolution had occurred. I would go so far as to say that it was the most important such evidence.

  20. keithskeiths

    Sal, to Allan:

    You’re not characterizing the real issue. Paternity tests among humans doesn’t have the added layer of having to prove mechanical feasibility of descent.

    Sal,

    The hypothesis of unguided common descent fits the evidence of the objective nested hierarchy trillions of times better than “common design”. That in itself constitutes overwhelming evidence against your “mechanical infeasibility” argument, even if we don’t consider all of the known mechanisms by which evolution proceeds.

    Your position is quite ridiculous. You have concocted an imaginary barrier to evolution, then invented an imaginary Designer to surmount your imaginary barrier. The end result is a pattern that matches exactly what you would expect if neither the barrier nor the Designer were real, and it doesn’t at all match what you would expect if common design were the correct hypothesis.

    To overcome the trillions-to-one explanatory advantage of unguided evolution over “common design”, you’re going to have to do a lot better than “well, maybe evolution is somehow mechanically infeasible.” The evidence is massively against you.

  21. Tom EnglishTom English

    phoodoo,

    You rarely comprehend what you address. You rarely say anything new. You never say anything of substance.

    I’m putting you on ignore. I wish others would do the same. But they seem to enjoy despising you. So I will ask instead that they stop quoting what some of us would rather not see.

  22. phoodoo

    Joe Felsenstein,

    Subtlety is not lost on you, huh Joe?

    Do you think people who have an interest in biology need to look up online to find out who Richard Dawkins and Jonathon Wells are?

  23. phoodoo

    Tom English,

    You could always just ask Patrick to censor the dissenters even more here Tom if your sensitive little ears hurt too much. I mean, I know he is already trying his best, but I am sure he can make up some more excuses to move posts.

  24. RumraketRumraket

    phoodoo: To Wit: Why should there be convergence at all!!

    The laws of physics are the same everywhere. Environments are often similar despite being separated by large distances and so on and so forth. That means organisms that live there are subject to similar selective pressures. That’s why convergence happens at the phenotypical level. Most fish are slim “torpedo shaped” for that reason, to reduce aquadynamic drag. That’s a form of convergence.

    phoodoo: Who, with any kind of honest intellectual skepticism at all, would believe that a theory that says, we start with nothing

    That’s your “theory”. You really enjoy trying to make evolution look ridiculous with empty rethoric, but the hilarious irony is that every time you do that you inadvertently describe a form of supernatural divine creationism.

    Evolutionary theory does not postulate we start with “nothing”, whatever the fuck you mean by that.

    phoodoo: we accidentally get copying which is often erratic and error prone

    Erratic, error-prone accidental copying. Check. I think you need a few more rethorical devices to tell us how much you want to make it appear ridiculous. I suggest you spice it up with “random”, “unguided”, “mistaken” and “chaotic”.

    phoodoo: and sometimes these accidents pile-up one on top of another to (lacking any design or plan)

    Oh, the erratic, error-prone accidental copying is lacking design and plan? WHOAH why didn’t you just say so before?????, you could have saved us all so much time.

    phoodoo: form complex organized, extremely intricate systems.

    You forgot irreducible, interlocking, specified, algorithmic, extravagant, mindboggling, cybernetic, self-sensing, high-fidelity, multi-component, co-dependent. That would REALLY have settled the deal for me.

    phoodoo: And sometimes this completely unplanned

    As opposed to just 80% unplanned…

    phoodoo: unorganized meaningless accidents

    Now you’re getting it. Unorganized and meaningless. PRAISE THE LORD!

    phoodoo: results in the exact same thing, multiple times!!

    .. at least multiple times.

    No seriously, Tom is right. Welcome to ignore you galactic ignoramus.

  25. phoodoo

    Rumraket,

    The laws of physics are the same, so THAT’S why we should expect fingerprints, and jaws and eyes to appear repeatedly from a series of accidental copiers?

    Interesting analysis.

  26. Allan Miller Post author

    stcordova,

    You just seem to ignore the substance of the OP.

    There is a pattern. It needs explaining. Common Descent does that, non-circularly. Are you saying that the logic is not circular when (by your determination) relationships are ‘mechanically feasible’, but it is circular when they aren’t? That makes no sense.

  27. Allan Miller Post author

    Tom English,

    Creationists who bother with the data invariably play divide and conquer. They isolate just as small an area of investigation as they can, do their utmost to give the impression that evolutionary theory hangs in the balance, and lay on with rhetoric designed to impress the rubes.

    This is the kind of thing we are seeing with the response on ‘convergence’. The tree overwhelmingly branches, on all scales, yet a few potential anomalies are obsessed over as destructive of the entire edifice. Which makes the title of my OP ironic – I tried to pull back to the ‘big picture’ and it’s “no, no, look at this little bit here!”

    As to going off-topic … there is rarely a discussion that stays on!

  28. Allan Miller Post author

    One thing I hinted at that perhaps needs more emphasis: using different character states means that the relationships are being tested independently. You don’t necessarily need ‘something-other-than-homology’ to verify homology.

    If 19 loci, with a mix of coding, noncoding and mitochondrial sites, and indels, give a broadly congruent tree in varying combinations, this is very hard to explain by any other means than Common Descent. If such a relationship seems ‘mechanically infeasible’, so much the worse for that intuition.

  29. phoodoo

    Allan Miller,

    Yes, but then you also have to accept, that when you have branches in the tree that are broadly in-congruent, this is evidence against common descent.

  30. OMagain

    Evidence against common descent must be evidence in favour of something else. What is that something else?

  31. OMagain

    Evidence for common descent must be evidence disconfirming something else. What is that something else?

    If there are more types of evidence of one sort then another, why do you grab onto the smaller pile instead of the larger pile?

  32. phoodoo

    OMagain,

    Because all of the evidence for common descent is just as reasonable as evidence for common design. Plus we don’t have to worry about all the pesky evidence of convergence which to any reasonable person should be the death knell of Darwinian evolution.

    Even if John Harshman wants to stick his fingers in his ears.

  33. dazzdazz

    phoodoo:
    OMagain,
    convergence which to any reasonable person should be the death knell of Darwinian evolution.

    Have you never wondered why only religious wingnuts think that’s the case?

  34. OMagain

    phoodoo: Because all of the evidence for common descent is just as reasonable as evidence for common design

    You a moment ago said that you have to accept that when you have branches in the tree that are broadly in-congruent, this is evidence against common descent.

    Likewise, you have to accept that when you have branches in the tree that are broadly congruent that’s evidence for common descent. And there are far more branches showing that then that are in-congruent I’m sure you’d agree.

    Yet you don’t accept that as evidence for common descent whereas you expect other people to accept the inverse.

    phoodoo: Plus we don’t have to worry about all the pesky evidence of convergence which to any reasonable person should be the death knell of Darwinian evolution.

    And as that has not actually happened it would serve you well to ponder why. Either you are wrong or they are wrong. Given the above demonstration of your apparent unwillingness to accept what you ask others to accept my money is on you being wrong.

    Anyway, I think the growing consensus that you should simply be ignored is correct. As such this will likely be my last response to you. As you’ve noted my responses are fact-free previously this won’t be great loss to you I’m sure.

  35. OMagain

    dazz: Have you never wondered why only religious wingnuts think that’s the case?

    What’s especially interesting is that comment comes after some great explanations as to why you’d not expect that to be the case. It’s very telling as to the agenda that the anti’s choose to pretend those explanations don’t exist (very much fingers in ears la la la) as it simply shows their inability to address them. So they just skip over them and make the same points over and over again and wonder why everyone laughs and then get’s annoyed when it’s done for the 50th time!

    Phoodoo, if you are so right and sure of it, write a paper and get the DI to publish it on one of their many journals. Then tell someone to tell me that so I can take you off ignore and congratulate you. And I would genuinely mean it. Despite our differences the only arena that counts is the one where everyone gets the same treatment. If you want to play with the grown ups in their arena I would wholeheartedly support it.

  36. Allan Miller Post author

    In all known examples of morphological convergence, there are other character states in the same species that don’t show convergence – especially the genetic ones. They substantially outnumber the convergent states. That’s how you know it’s convergence, ffs! As often happens, Creationists are arguing that the bulk of the data is the anomaly.

    I am not aware of any example of molecular convergence extending beyond a few bases, embedded in a sea of non-convergent sequence. The noise is itself a signal, but it is not the only signal.

  37. phoodoo

    Allan Miller,

    But it still doesn’t explain convergence. Convergence makes no sense whatsoever, from a Darwinian perspective.

    It not only requires a fairytale to believe it, it requires a fairytale of a fairytale.

  38. OMagain

    Allan Miller: As often happens, Creationists are arguing that the bulk of the data is the anomaly.

    Were they truly following the evidence it’d all be different. But they don’t, so it’s not.

  39. RumraketRumraket

    Oh for fucks sake not that whole common descent vs common design tripe again. I think I’m just going to re-post this every time I see that crap.

    On intelligent design you expect NOTHING IN PARTICULAR. All patterns are possible, but no pattern is any more expected than another unless you already know something about what goes on in the mind of the designer(do ID proponents happen to know that their intelligent designer WANTS to design nesting hierarchies? No they don’t, it’s just an ad-hoc rationalization).

    All patterns are after-the-fact compatible with design, but none of them are exclusively or statistically predicted to appear over others when the designer and it’s methods are unknown.
    Yes, design CAN explain all the same observations as evolution by common descent. But only in an empty and ad-hoc fashion that lacks explanatory power. (As in, it doesn’t actually explain or predict why we see what we see).“That’s just the way the creative designer wanted to make it”. There is no WHY or HOW in the design-rationalization. It is nothing BUT a rationalization come up with after the fact of discovery of nesting patterns of similarities.

    Further more, why do human beings (the only intelligent designer we know of empirically) use “common design”? Mostly to save time and resources. Human beings copy previous designs because it is simply faster to do so when they need to make something that works. Nuts and bolts are reused because they work fine as they are, no need to change them. They are standardized, the factory has no good reason to invent new, sliiiiightly different ones every time (the same way we see, for example, regulatory regions mutate over time and phylogenies being constructible therefrom). Wheels are good for vehicles, easy to copy the basic pattern and save time, instead of having to re-invent a new method of locomotion every time. And build an entirely new factory to produce them.

    But, life wasn’t designed by humans, so we can’t use analogies to anthropomorphic tendencies with respect to design. The kind of designer most ID proponents think designed life is an omnipotent supernatural designer, unconstrained by a faulty or mediocre imagination, unconstrained by a lack of time, unconstrained by resources, unconstrained by materials or anything at all. Such a designer would have absolutely no practical reasons for copying it’s designs over and over again in a derivative fashion by re-using and slightly altering items and structures from previous designs, to include in new organism that appear as evolved derivations of previous ones. None of the inferences we use to infer human design took place, are valid inferences for an unconstrained, omnipotent divine designer who does not have human concerns of practicality such as resources, lack of intelligence, imagination, creativity and time.

    So there is a colossal ambivalence at the heart of the main ID proponents, who start with a conclusion that a specific and supernatural designer did the designing. This leads them into problems very quickly, for among other reasons that the nature, capacities and intentions of their designer, they assert, is unknowable, infinite and mysterious, respectively.

    But in science we work with what we got and from what we know:
    Observed designers, observed natural processes, observed manufacturing processes leaving observational evidence behind. The mechanism is understood, it makes testable predictions. It fits into already well-established frameworks of science from other fields: Physics, chemistry etc.(And in the case of human designs, human psychology, human inventions and technology and human culture). We can then form hypotheses and look for the results of the mechanism and either confirm or falsify the hypothesis.

    Now comes “ID”. Do it have a mechanism? Nope.

    What did it make? Depending on who you ask, all living organisms as-is, or occasionally it just dropped in to magically instantiate specific mutations at various points in the history of life, or zap a flagellum into existence.

    Does their designer leave a signature, product description or trademark behind?(Stainless Steel, Goodyear, Firelli, Made in Taiwan, Nike, Microsoft, Coca Cola, nVIDIA… ) Nope.

    Does it use tools? Nope (or no idea, things magically appear with no process of fabrication and construction).

    When did it operate? No idea, millions and billions of years ago and now it’s suddenly stopped entirely no new creations take place. No creation has ever been observed. No macro-creation, not even micro-creation. Simply put, we observe absolutely nothing at all that looks like it is being instantly created with divine magic.

    Do they draw analogies to human manufacturing processes? Well, they sometimes say that the designer re-uses old designs. What reasons do they have to expect their designer to do this? Since they don’t know the designers mind or intentions (they keep saying this to secular audiences), then they must be getting their idea from having seen human beings design things.

    Ok, let’s just run with that. Let’s try the “accepts common descent and some degree of evolution but occasionally dropping in to make specific mutations happen by screwing with atoms at the quantum-level” (theistic evolution ala Kenneth Miller’s ideas). What testable predictions does this make? It should look exactly like evolution happened.
    Just like evolution could have created all of life through mutations, drift and selection, with all the minor quirks and oddities being the result of incomplete lineage sorting, convergent evolution, drift, horizontal gene transfer and so on,
    all expected to happen but never statistically significantly deviate from the main pattern, so does theistic evolution become observationally indistinguishable from naturalistic evolution.

    In other words, an unobserved designer operating in the deep geological past, on a global scale, who has the ability to make specific mutations happen inside living organisms, is in competition with the observed fact that evolution happens naturally:

    A) Mutations observationally happen, and we have no good reason to think they wouldn’t in the past too.
    B) Those mutations affect the morphology and the physiology of the host organisms, and we have no good reason to think they wouldn’t in the past too.
    C) The phenotypical and morphological effects of those mutations affect the reproductive successs of the carrier organism, and we have no good reason to think it wouldn’t in the past too.
    So simply put, drift and selection observationally happens, and we have no good reason to think it wouldn’t in the past too.
    E) Environments observationally change, and we have good reason to think they did in the past too (all of geology and the Earth-sciences testify to this).
    F) Horizontal gene transfer observationally happens, and we have no good reason to think it wouldn’t in the past too.
    G) Incomplete lineage sorting observationally happens, and we have no good reason to think it wouldn’t in the past too.
    H) Convergent evolution observationally happens, and we have no good reason to think it wouldn’t in the past too.

    Which is the simplest, most parsimonious explanation of the observed shared derived characteristics in extant life, then? The observed one that doesn’t require us to erect uneconomical unobserved entities: Evolution.

    Ok, fuck that then. Moving on to the “all life made as-is” (space-aliens with superduper technology-ID-creationism).

    Well, we should expect to find similarities between some species(still re-using old designs).
    Ok, we find that. But we have at least two hypotheses that predict this same feature, so can we distinguish between them? Well, evolution predicts congruent nesting hierarchies in morphology, anatomical features and genetics.

    But designers have been known to design nested hierarchies too.

    Sure, but again the reasoning is arrived at ad-hoc. Mere re-using of old designs should not in itself yield highly congruent multiple nesting hierarchies into which all of life fits to an extremely high degree of confidence.

    No, but it still could have been designed.

    Yes! But why would we believe it was beyond the mere possibility? What grounds are there to believe that this is what happened?What are the odds that, even if you as a “designer” sits down and thinks “I’m going to reuse some of my older designs”, inadvertently produces a nested hierarchy, into which every species on the planet fits, both genetically, morphologically (and chronologically in the fossil record)? And why would you do it deliberately? What are the odds that your designer sat down and designed this specific pattern?

    Does the observed nested hierarchy even make sense with respect to known, human designers method of design and manufacture?

    Let’s see:
    A look into the mind of the designer of the nested hierarchy:
    “Common design – common designer” (by deliberately forming sets within sets within sets).

    Here’s a small insight into it’s train of thought (courteously trying to give ourselves reason to entertain the design hypothesis by drawing from the only intelligent designer we know of – Homo Sapiens):

    Oh, I’m going to design a bacterium with a genome like this (the first genome!).
    AAAGGGCCCTTTAAGGCCTTAGCT

    Oh, I want to design another organism, re-using some of my bacteria designs(the “common designs”-argument), so it looks like this new organism genetically and morphologically mostly derives from the first one.
    AAAGGGCCCTTTAAGGCCTTAGCA

    Oh, I’m going to design a 3rd organism, this time re-using designs from the 2nd organism, so it looks like it mostly derives from the 2nd one.
    AAAGGGCCCTTTAAGGCCTTACCA

    Oh, I’m going to design a 4th organisms, this time re-using designs from the 3rd, so it looks like it mostly derives from the 4th one.
    AAAGGGCCCTTTAAGGCCTAACCA

    Oh, I’m also, intermittently, going to go back and re-tweak my previous creations, so that it looks like they each independently changed since I first created them.
    1st Organism: TAAGGGCCCTTTAAGGCCTTAGCT
    2nd Organism: ATAGGGCCCTTTAAGGCCTTACCA
    3rd Organism: AATGGGCCCTTTAAGGCCTTACCA
    4th Organism: AAAGGGCCCATTAAGGCCTAACCA

    Not only am I going to do this, mysterious designer as I am, I’m going to do it in such a way that the degree of change it looks like they underwent, is directly proportional to how old their time of divergence will look like if calculated from number of nucleotide substitutions(and estimated from the fossil record). Haha, take that – future humans whom I’m going to create at some point too!

    Anyway, back to business, creating a 5th organism, this time re-using designs from the 4th, so that it looks like it mostly derives from the 4th one.
    ACAGGGCCCATTAAGGCCTAACGA

    Oh, I just got a brilliant idea! I’m going to go back to the first organism I designed, and then derive a whole new “branch” from it. But I’m not going to be deriving this branch from the original genome I first created, no, I’m going to change it slightly so it looks like that first genome evolved for a time before this new “divergence” happened, THEN I’m going to make the new “branch”.
    1) TTAGCGCCCTTTAAGGCCTTAGCT
    1a) TTAGCGCCCTTAAAGGCCTTAGCT (independently derived from 1)
    1b) TTAGCGCCCTTTATGGCCTTAGCT (independently derived from 1 also)
    There, perfect!

    Oh, I just got another brilliant idea. In addition to the intermittent return to tweaking the genomes of previously designed organisms, I’m going to do the exact same I just did to the first lineage: Intermittently derive more independent branches off of each of the 2nd, 3rd, 4th, 5th (and so on) “linages” I created, using the same hilariously illogical method I just used to create a branch off of the 1st one. Brilliant!

    And I’m going to do this for millions and millions and millions of species. And to top it all off I’m going to kill billions of them in intermittent extinction events, burying them in the millions in seemingly temporal order matching with morphological and genetic sequence, so that it just so happens to look like they left incrementally changed descendants over a very long timescale.

    I wonder what the odds of me creating and designing life, exactly using this method is? I wonder if it even makes sense to postulate that anything would do “design” like this? Hmmm.

    Does this make sense to postulate? No, it doesn’t. No mentally healthy intelligent designer would operate like this and produce a nested hierarchy indistinguishable from the one produced by the evolutionary process.

    I submit that if you can convince yourself that your designer operated like this, then you’re either insane, deluded or infinitely gullible. Regardless, it would be irrational to believe it.

  40. Allan Miller Post author

    ‘Common Design’ is one of the dumber ideas to come out of the Creationist community.

    Pick an actual example. Let’s see a gene held in common between two clades you regard as NOT commonly descended whose similarities are due to Common Design.
    Then offer up another (or the same) sequence held in common between two clades you DO accept as commonly descended. Let us compare the two, and the reasoning behind them.

  41. Allan Miller Post author

    Pick an actual example.

    And, while we are at it, an actual example of molecular or morphological convergence which is a problem for ‘Darwinian evolution’.

  42. stcordova

    All in all, much too vague to be worth much as a reply. You toss around “mechanically infeasible” as if anyone knows what you mean. What, for example, is “mechanically infeasible” about a common ancestor of tigers and butterflies, or tigers and grass?

    We can experimentally demonstrate a chimp gives birth to a chimp. You can’t experimentally demonstrate a rose bush and chimp will birth to anything together. If you don’t understand the mechanics of nature, you have problem.

  43. dazzdazz

    stcordova: We can experimentally demonstrate a chimp gives birth to a chimp. You can’t experimentally demonstrate a rose bush and chimp will birth to anything together.If you don’t understand the mechanics of nature, you have problem.

    Ah, the good old “you can’t reproduce macroevolution in a lab”. I guess since we can’t produce planets in a lab then accretion and gravity are mechanically infeasible to produce celestial bodies

  44. John HarshmanJohn Harshman

    stcordova: We can experimentally demonstrate a chimp gives birth to a chimp. You can’t experimentally demonstrate a rose bush and chimp will birth to anything together.If you don’t understand the mechanics of nature, you have problem.

    Are you seriously trotting out the “dog gives birth to a cat” version of evolution to attack? If all you mean by “mechanically infeasible” is that major transitions can’t happen in a single generation, it’s definitely to your advantage not to get specific. Your firm stand against inter-kingdom hybridization does you no credit either.

    You also seem to be making the claim that every species was separately created, that every species is incapable of any change, and that speciation never happens. Otherwise, what you say above makes no sense. Would you like to defend those claims explicitly? Probably not, as vague is your friend.

Leave a Reply