The Blind Watch Dropper

Here is one of the more essays I wrote based on discussions I’ve had hereon and on other sites like Pandas Thumb. I think this is one of the more appropriate essays for discussions here and it also happens to be one I feel is fully finished at this point. Well…I’m happy with it, but clearly I may edit it a bit given constructive criticism… 🙂

______________________________

I haven’t seen much press on this lately, but back in the late 1980s, Creationists – a slice of Christians who hold that the creation of the universe, Earth, and all living things on Earth were created by God exactly as described in the Christian Bible and that the Earth is roughly 10,000 years old…tops – tried an end around to the 1987 Supreme Court decision (Edwards v. Aguillard) barring the teaching of Creation Science in public schools. The attempted end-around was called Intelligent Design (ID).

ID, boiled down, is essentially a dressed up version of William Paley’s The Watch and The Watchmaker argument for the existence of God, or rather, a slightly gussied up Teleological Argument for the Existence of God. Paley’s argument goes like this: if you stumble upon a rock in the woods, you could reasonably surmise that it had been there, in that state, forever (keep in mind that Paley wrote his analogy in 1802 and was not familiar with what we now know about geology and in particular plate tectonics and erosion and similar forces. So, he can be forgiven for thinking that some items of the universe (like planets and stars) and the Earth (like soil, rocks, mountains, rivers, land masses, and so forth) exist unchanged forever) as a simple object of nature. By contrast, if you stumble upon a watch, you would not think that this item had been there forever, but rather you’d likely think that this item reflected the intent of a creator and, in particular given its complex parts working in intricate harmony, functions specifically for a purpose the creator designed it for. Given this, by analogy one can reasonably look at the universe and, seeing its complex interactions working in intricate harmony, infer it too must be designed and conclude, therefore, there is an ultimate Designer.

All Teleological Arguments rely on the same basic argument: certain features and functions of the world exhibit complexity that appears far too harmonious and intricate to have occurred by accident and thus must have been intelligently designed. Ergo…God.

It’s helpful to understand a bit about the history and use of the concept to better understand the application of teleology in theology, but it’s not absolutely necessary. That said, here are a definition and a brief summary:

Teleology comes from the Greek telos, meaning end (as in goal or purpose), and logos, meaning reason. So, teleology is about understanding the purpose of things. In its most basic form, teleology is the study of the purpose that phenomena serve rather than the cause by which they arise in order to provide an explanation for the phenomena. In other words, teleologists hold that the purpose for the sky being blue is more useful in understanding aspects of the world than studying and understanding optics and the Rayleigh Diffusion Effect. I admit, I’ve had no luck digging up a teleological explanation for the sky being blue, but apparently there used to be some popular ones back before modern science’s explanations. The point is, teleology attempts to address ‘why’ things occur, as opposed to scientific approaches that attempt to answer ‘how’ things occur. It’s also worth understanding that teleology, particularly as popularized by Aristotle and Plato in their day, was a reflection by analogy of the fact that nearly all human endeavors are goal-oriented and purpose driven. Thus by analogy, Aristotle saw the universe as rational and purposeful – analogous to human rational and purposeful behavior – and thus felt that all phenomena can only fully be understood when one considers and appreciates the purpose of the various phenomena.

There are a number of issues I have with teleological arguments and perspectives, but I’m going to focus on four main issues here.

First and foremost, technically there is no actual argument in the teleological approach to the existence of God as it’s simply a tautology and thus question begging. If your philosophy’s premise assumes that all things have purpose and goals, using that philosophy to argue for a goal-oriented and purpose-creating designer is simply restating your premise’s assumptions. It’s just arguing in a circle. Intelligent Design tries to dress the argument up a bit by focusing on complexity vs purpose and goals, but the issue remains the same. In ID, the argument is changed slightly to certain biological and informational features of living things are too complex to be the result of natural selection (or natural processes) and therefore must be the result of intentional and rational (intelligent) design requiring an intelligent designer. This, of course, suffers from the same tautological issue noted above: the first premise of ID is that living things are too complex to be the product of natural processes, but if the premise is that living things can’t come about from natural processes, what’s left? By premising that living things can’t be the product of natural processes, the premise implies something other than natural processes – i.e. design processes. To then conclude a designer is simply restating the premise. Yet again, a tautology.

Next, there’s the fallacy of the General Rule. The fallacy of the General Rule is a logical fallacy wherein someone assumes that something in general is true in all possible cases. A standard example is the claim that “all chairs have four legs”. But clearly rocking chairs have either no legs or two legs, depending on the design, and there are plenty of modern chair designs with three legs, and not a few bar stools that are essentially held up on a single pole. In the case of ID, the assumption is that complexity implies design and since biological objects are complex they must be designed. The thing is though, not all designed things – well, human designed things – are complex. Consider toothpicks, paper clips, floss, and Popsicle sticks as but a few examples. These objects are never used in teleological arguments for obvious reasons. And while it’s certainly possible that a toothpick could come about through natural processes, we know a human-designed toothpick when we see it and not because of the harmonious workings of its complex parts. No, it’s because of two things: man-made toothpicks have tell-tale evidence of being manufactured and they exist in greater collected numbers than nature could reasonably produce.

Another issue with ID that is related to the fallacy of the General Rule noted above is that it relies upon a false dichotomy. A false dichotomy is a logical fallacy wherein someone argues that some condition has only two alternatives when in fact there are more. An example would be someone who insists that the only alternative to driving a car is walking when clearly bicycles, skateboards, pogo sticks, and air travel all exist. In the case of ID, even if one were to agree that most, if not all, living organisms are too complex to have come about through evolutionary processes, it’s questionable at best whether a designer (and specifically God) is the only alternative. There are abundant natural processes that lead to complex organized structures (think snowflakes, tree rings, and the Giant’s Causeway). And even if we grant a necessitated designer, since there’s no way to assess or know anything about the supposed designer inferred by ID, the designer could very well be invisible pink unicorns or aliens. The bottom line is that it’s a rather large (and unrealistic) stretch to assume the only way to get biological complexity is either evolution or God.

Lastly, as noted above, we don’t infer design from complexity so much as we infer design from indications of manufacturing. This, for me, the primary failure of all forms of teleological arguments for the existence of God and ID in particular.  Designs are a very specific form of plan and planning. We make designs (usually written and drawn) to help us visualize how various components and processes will interact and work in a given environment in order to (hopefully) highlight problems and issues before we actually manufacture the object of design. So the truth is that looking at an object tells one very little about the actual activity that went into designing that object. And while looking at an object can indicate something about whether the object was designed, it’s really the indications that the object was manufactured through some tool use process that provides that inference. Manufacturing leaves evidence; design does not.

I’ve never found the ID arguments for the design of biological organisms all that compelling for a number of reasons. The dubious math, the fallacious arguments, the disingenuous bait and switch to Christian apologetics, and so forth. But even beyond that, there was something about the objects in nature – organisms themselves – that just don’t seem designed to me. There is something different about them compared to man-made objects, but I was not able to put my finger on what I felt the difference was. And then it hit me one night: replaceable parts.

All man-made objects – every single one – are either designed specifically to be replaced or have components that are designed specifically to be replaced. Why? Because tool users and manufacturers learn really quick that tools and/or certain parts of tools wear out. So as designers, we anticipate the need for maintenance.

No such anticipation or planning for maintenance can be found in nature. None. If something breaks in an organism, either that organism learns to live without it or it dies. Or, in the case of humans, that part gets replaced by human designed or human configured replacements (as in my case). But even in the later case, humans have to create a work-around, because biological parts actual resist being replaced. You can’t just replace human parts with other human parts willy-nilly. In most cases, the new parts just won’t work, or worse, they’ll be rejected by the body’s immune system. But of particular note, there’s no surplus of replacement parts anywhere; no storage unit somewhere with a bunch of eyes or hearts or toes or hair or kidneys or…anything. Not even bark or leaves or antennae or scales. Nothing.

Of course, this makes perfect sense given evolution and other similar natural processes. It makes no sense if there were an actual designer, particularly an omni-god Designer, behind it all.

601 thoughts on “The Blind Watch Dropper”

  1. Alan Fox: No, phoodoo, I don’t think there is a coherent concept of consciousness

    Maybe it doesn’t exist then?

  2. phoodoo: Maybe it doesn’t exist then?

    To quote Justice Potter Stewart, I can’t define it but I know it when I see it.

  3. phoodoo: Maybe it doesn’t exist then?

    That is my current view. Consciousness is not a coherent concept. You’re welcome to have a different view.

  4. Alan Fox,

    Alan Fox: That is my current view. Consciousness is not a coherent concept. You’re welcome to have a different view.

    Who are you talking to?

    Who are you?

  5. Flint: To quote Justice Potter Stewart, I can’t define it but I know it when I see it.

    I figured that the only people worth explaining it to may already be familiar with being conscious.

  6. Alan Fox: Not in a coma, you mean?

    Not UNconscious, at any rate.

    I have to admit that I do not quite follow what you mean when you say that consciousness is incoherent. People unfamiliar with the phenomenon are usually in no position to express this.

  7. I mean in a dualist way. For me, cognition is a result of neural activity, what the brain does. Brain activity is what is going on, there is nothing extra added by using the word “consciousness” therefore nothing else to define or explain. Even the Glasgow scale is a measure of brain activity.

  8. Alan Fox: I mean in a dualist way. For me, cognition is a result of neural activity, what the brain does. Brain activity is what is going on, there is nothing extra added by using the word “consciousness” therefore nothing else to define or explain. Even the Glasgow scale is a measure of brain activity.

    Ah, I see.
    Me, I am a simple soul and I like to have words for stuff. For example, my car moving is the result of a car doing what it does. Still, I don’t think that renders the word “transport” incoherent.
    In the same way, I think the word consciousness is perfectly fine for describing that state of being aware of going-ons, even though you won’t get any explanatory value out of it as to how that state arises from an active nervous system.

  9. Fair Witness:
    Steve: …Our bodies are able to scan their own DNA, detect errors and repair them to the best of its ability…

    Corneel makes a good point about how errors accumulate despite the error correction. Even PC operating systems have better error correction than our DNA. What kind of buffoon designed us? Is he not even as smart as Bill Gates?

    To think that achieving perfect copying fidelity is optimal is a very anthropomorphic way of looking at processes. That may be okay for books or pc programs but there is an integral wisdom that ensures life is much more dynamic than perfect copying would allow.

    Any engineer will tell you that a perfect fit is sometimes the last thing that is needed.

    Have you ever thought that it possible you are failing to see the bigger picture?

  10. Corneel:
    phoodoo: I wonder where it is in a cat’s DNA that teaches it to stretch it paws out, and arch its back to loosen up its muscles and make it more agile? Since all cats do it, I guess it could just be an emergent property of far from equillibrium states.

    Corneel: After some meticulous research I found the genomic region that is responsible for this typical cat behaviour. Interestingly, it turns out to be a repeat region:

    CATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT

    And the system is that smart it can even be read in reverse thus allowing the CAT to ACT. 🙂

  11. DNA_Jock:
    phoodoo just doesn’t realize that things WERE different in the past

    Yes, life progresses. Self-consciousness has emerged in evolutionary time, just as our self-consciousness emerges every time we awaken from a good night’s sleep. The whole reflected in the parts.

  12. Kantian Naturalist to phoodoo:
    Whether we should ever use the concept of emergence, however, depends on how we specify both what the “levels” are — what are x and y such that x is emergent with respect to y — as well as the crucial question of how x emerges from y.

    Life emerges from the earth as a baby emerges from its mother. The parts reflect the whole. Life emerges from life.

  13. Flint in reply to Kantian Naturalist:
    This is becoming a fascinating thread. I’ve always got the impression that consciousness however defined emerges as a side-effect of the firing of a huge number of neurons in some more-or-less organized way. Apparently for a few organisms, this side-effect works as a survival mechanism (among many others). So that’s one level. And anyone who has owned a dog or cat knows that personality emerges as a side-effect of consciousness. Another level. And numerous other qualities (like leadership ability, tolerance, patience, etc.) emerge as side-effects of personality. Lots of layers to consider.

    I’m not so sure we have a good handle on what intelligence is, though. Sure, we have plenty of ways of measuring intelligence, but as Gould once wrote, while everything that exists can be measured, it’s not certain that everything that can be measured exists. I don’t know how to disentangle intelligence from consciousness, instinct, brain structure, and training.

    How would you know of neurons and dogs and cats and brains and yourself without some form of consciousness? Do you know of these things when you are in a deep sleep? Do you admit to having ever been unconscious?

  14. Alan Fox:
    Flint: I don’t know how to disentangle intelligence from consciousness, instinct, brain structure, and training.

    Alan Fox: I don’t think there is any need. Consciousness is too nebulous and variable as a concept to be useful except in medicine, with the Glasgow scale of consciousness. I try to avoid using the word, except as a way to describe a state varying between full alertness and brain death.

    Intelligence can be dispensed with, too, except maybe when making or testing intra-species comparative cognitive abilities.

    So if you can’t kick it it doesn’t exist, is that it?

    Does love exist, or thinking, or desire? If you are aware of them then you are conscious of them. Or can you be unconsciously aware?

  15. Kantian Naturalist in reply to Flint: We don’t know how to operationalize consciousness, and in fact I’m skeptical that it can even be done.

    We do not have to do this simply because we experience it directly. I know I feel hungry without having to define the experience.

    Kantian Naturalist: There is some really interesting work on consciousness these days that I know about comes from observing the changes in brain physiology, based on MRI scans, as a result of teaching people how to practice mindfulness meditation.

    The interpretation of MRI scans requires consciousness. 🙂

  16. Alan Fox:
    CharlieM: How should consciousness be defined? Any minimal definition is indeed pretty useless.

    Alan Fox: The best approach is not to use a word you are unable to define. In fact, I defy anyone to define consciousness in any way that is useful.

    I think I already mentioned the Glasgow scale of consciousness. I see it is now referred to as the Glasgow coma scale. Someone is listening to me after all.

    Google the “Glasgow coma scale”, and you get various results which tells you it is a measure of levels of consciousness. Being in a coma means that the person is in a very low state of consciousness. Using the word “coma” is meaningless without its relationship to consciousness. they may not use the word but the concept will be there.

    In the famous “Gorilla on the Basketball Court” demonstration, some people will have been aware of the gorilla, some not, but all will have had similar information on their retinas. What is this if not a difference in their conscious awareness?

  17. Corneel: …you won’t get any explanatory value out of it as to how that state arises from an active nervous system.

    Exactly.

    And I drive my car, it doesn’t transport me. Though to be fair, my wife hates my driving and transports me everywhere when we travel together by car.

  18. Alan Fox to Corneel:
    I mean in a dualist way. For me, cognition is a result of neural activity, what the brain does. Brain activity is what is going on, there is nothing extra added by using the word “consciousness” therefore nothing else to define or explain. Even the Glasgow scale is a measure of brain activity.

    In order for you to form all these beliefs you hold the concepts you are using must enter your consciousness.

  19. CharlieM: Does love exist, or thinking, or desire?

    Yes in the sense that love and desire are emotions and thinking is neural activity.

    If you are aware of them then you are conscious of them.

    Awareness is the concept. If you want consciousness as just a redundant synonym for awareness, be my guest.

    Or can you be unconsciously aware?

    Not if conscious is a synonym for aware, nor if you are referring to the Glasgow scale.

    Do you claim consciousness is a thing rather than a process, if I may make so bold, a physical process? Then tell me how you get there.

  20. CharlieM: In order for you to form all these beliefs you hold the concepts you are using must enter your consciousness.

    “Enter my consciousness” means what? That I need to be aware and think about them? What else? Anything else?

  21. Alan Fox:
    Corneel: …you won’t get any explanatory value out of it as to how that state arises from an active nervous system.

    Alan Fox: Exactly.

    And I drive my car, it doesn’t transport me. Though to be fair, my wife hates my driving and transports me everywhere when we travel together by car.

    How do you know you drive the car? How do you know it doesn’t read your mind and take you to where you desire to go?

  22. CharlieM: To think that achieving perfect copying fidelity is optimal is a very anthropomorphic way of looking at processes. That may be okay for books or pc programs but there is an integral wisdom that ensures life is much more dynamic than perfect copying would allow.

    Any engineer will tell you that a perfect fit is sometimes the last thing that is needed.

    Have you ever thought that it possible you are failing to see the bigger picture?

    I am an electrical engineer, and a software engineer.

    I am aware that sometimes looser-than-perfect tolerances are needed for physical parts to work well together; that is not what we are talking about with copying of a genome from one generation to another.

    For “front-loading” of all the genomes to work across 4 billion years, it would require perfect fidelity in the copying process. We know that the copying process in biological organisms is far from perfect. In humans we see 80-120 errors per generation.

    By reductio ad absurdum, front-loading cannot be what is happening.

    I am also aware that an engineer should not be making assertions about biology without checking with biologists or geneticists, so if anyone in those fields can see problems with my logic, please correct me.

  23. Alan Fox:
    CharlieM: Does love exist, or thinking, or desire?

    Alan Fox: Yes in the sense that love and desire are emotions and thinking is neural activity.

    CharlieM: If you are aware of them then you are conscious of them.

    Alan Fox: Awareness is the concept. If you want consciousness as just a redundant synonym for awareness, be my guest.

    CharlieM: Or can you be unconsciously aware?

    Alan Fox: Not if conscious is a synonym for aware, nor if you are referring to the Glasgow scale.

    Do you claim consciousness is a thing rather than a process, if I may make so bold, a physical process? Then tell me how you get there.

    I’m happy to equate consciousness with awareness, are you?

    Thinking is not neural activity. The most you can say is that thinking might in some way correlate to neural activity. You are directly aware of your thinking but you are not directly aware of your neural activity.

    Consciousness is an experience so it is more an activity than a thing.

  24. CharlieM: How do you know you drive the car?

    Because I am aware of the process. It can be scary for others but I quite enjoy it.

    How do you know it doesn’t read your mind and take you to where you desire to go?

    That’s a much less parsimonious hypothesis with no mechanism. How could we test it?

    There’s actually a serious point we are all up against in that self-analysis is doomed to failure by the simple fact that no sentient entity can understand anything as complex as itself.

  25. Corneel: Could it be that you overlooked my comment altogether? I seem to be unable to find your response.

    However, this part I found extremely amusing:

    Do you seriously believe that you drinking your spinach smoothies has stopped mutations in your DNA from happening?!? ROFLMAO!

    Corneel, you have got to be the most obtuse poster here. I think you designed it that way! :P. It allows you to avoid confronting the obvious.

    Nobody said good nutrition will stop mutations. What good nutrition does is help the body work optimally to reduce the amount of errors in the system. Our continued intake of processed and overcooked foods has a huge detrimental effect on the body’s ability to repair problems. Thats the difference between dying at 55 or dying at 105.

    Just ask the seaweed eating Japanese.

  26. Alan Fox: Because I am aware of the process

    I think aware is a completely incoherent notion. Can you define it?

    And I haven’t the foggiest idea what you mean by you.

    Well, this is what I would believe if I believed you.

  27. Corneel: Why does it need adefense mechanism, I wonder? Against what? It is the first cell. Also, I’d sure like to see some cells with a digestive system. Could you post some pictures of those?

    Again, the obtuseness-ness.

    The proto-cell needed defense against the environment in order to avoid the breakup of its fortuitous congregation of homeless chemicals. If not for its defensive capability, how did the proto-cell hold on to what it achieved?

    As for a digestive system, are you saying you cannot envision the make-up a primitive, rudimentary digestive system? Like a proto-cell absorbing energy from the sun and pushing chemical by-products out?

    You. Can. Do. Better.

  28. Allan Miller: It is. I was going to post similar. The front loaded genome has to have every future genome in the same cell. All the variety; each gene variant separately represented. It would take several months just to replicate once. It’s a useless idea.

    I think intuition may not be your strong suit.

    The first genome would have had all the information contained in itself for the unrolling of life. A meta program able to hold all designs in a super-compressed form. Humans can understand these concepts if only in a rudimentary way.

    In fact, humans are still raving about how much information can be stored in DNA. It is a multi-faceted molecule humans are unable to replicate. We need to call in the chinese for their copying expertise. I was gonna call the Taiwanese but they moved on to ODM.

    So no, it is not inconceivable that the first genome contained all the information necessary for the rolling out of lifeforms. Biological programming at its finest.

    Design offered huge opportunities for thinking out of the box when trying to understand genomes and how to imitate them? Non-teleological evolution narratives are treading water. No new ideas.

  29. Steve: Nobody said good nutrition will stop mutations. What good nutrition does is help the body work optimally to reduce the amount of errors in the system.

    You are trying to have your cake and eat it too. No, you definitely claimed that “[e]volution is dead. It was rolled out to create the biosphere then went dormant when the task was completed.” and that “[n]ow all we see is maintenance programs at work, detecting defects, repairing as best can do.”

    That is a bold claim, so I asked:

    But despite DNA polymerase proofreading and various repair mechanisms, mutations happen nonetheless. What is going to stop them from accumulating?

    You never answered (don’t think I do not notice), but instead reacted to Fair Witness’s related question about poor Design:

    Corneel’s objection was answered in the part of the comment I made that was not pasted into his post. Our bodies are well capable of maintaining and repairing our bodies if we would just not get in the way. Thanks to our poor diet and activity decision making, our bodies are playing a losing game.

    Well, no, you did NOT answer my objection, not even after me calling your attention to it a second time. What you did do was suggesting for the second time that mutations are inconsequential for evolution because they are taken care of by DNA repair mechanisms.

    So, for the third time:

    1) Do you agree that polymerase proofreading and DNA repair mechanisms cannot prevent mutations from happening, not even in species that are able to drink vegetable smoothies on a regular basis?

    2) If we can agree that mutations are continuously entering populations of organisms; Then what is stopping them from accumulating?

  30. Fair Witness: And, given our inferior error correction mechanisms, not only would OUR genome accumulate mutations, but every future genome would as well.At the rate of 80-120 mutations per generation, computed over 4 billion years, all those future genomes would end up as, well, JUNK !

    This assumes mutation rates have been constant since day one. It is safe to assume that mutation rates were much lower in the past.

    As well, inferior error correction rate as compared to what? You cannot compare a biological error correction rate to a human designed computer’s error correction rate. Different animals.

    When you have designed a biological entity with a higher error correction rate than current organismal designs, then you might have a point.

  31. For “front-loading” of all the genomes to work across 4 billion years, it would require perfect fidelity in the copying process. We know that the copying process in biological organisms is far from perfect. In humans we see 80-120 errors per generation.

    By reductio ad absurdum, front-loading cannot be what is happening.

    Front-loading entails the rolling out of a program. The copying process you are talking about is after the roll out. As well, you cannot use the current error correction rate as you have no idea if that rate has been constant over time. In fact, it make sense that the error correction rate in the past was lower.

    Front-loading makes plenty of sense in a technically advanced design – highly compressed information methodically unpacked in time-released increments.

  32. Steve: The proto-cell needed defense against the environment in order to avoid the breakup of its fortuitous congregation of homeless chemicals. If not for its defensive capability, how did the proto-cell hold on to what it achieved?

    Aaaaah, you meant defense against the environment. Sure. And what particular environmental threat did you have in mind? If some nook of the prebiotic environment was conducive to the assembly of a cell (say a lipid vesicle containing some biopolymers) why would decomposition suddenly outweigh self assembly and biosynthesis?

    I also love how you are talking about THE proto-cell. It appears to be quite hard for creationists to detach themselves from the idea of a single ancestor (male, of course). It is quite unlikely however that, given that a favorable environment existed, it gave rise to a *single* lipid vesicle that started the whole show.

    Steve: As for a digestive system, are you saying you cannot envision the make-up a primitive, rudimentary digestive system? Like a proto-cell absorbing energy from the sun and pushing chemical by-products out?

    Biologically speaking, digestion is the breakdown and chemical conversion of food particles. In my book, sunlight does not qualify as a food particle. In addition, where did you imagine the food came from? Unless you are referring to spontaneously synthesized carbohydrates, food particles derive from living organisms. It is therefore quite likely the most early lifeforms were chemoautotrophs. You seem to continue having trouble with the fact that we are talking about the very first cell.

    Steve: You. Can. Do. Better.

    Upthread, DNA_Jock mocked the “Twas ever thus” attitude of many creationists. Let me assure you that you too are well deserving of this epiphet. Please, try to wrap your head around the fact that four billion years ago things were very different.

  33. Steve: Front-loading entails the rolling out of a program. The copying process you are talking about is after the roll out.

    Wait what?!? DNA was not being copied? How does that work?

  34. Corneel: You are trying to have your cake and eat it too. No, you definitely claimed that “[e]volution is dead. It was rolled out to create the biosphere then went dormant when the task was completed.” and that “[n]ow all we see is maintenance programs at work, detecting defects, repairing as best can do.”

    That is a bold claim, so I asked:

    You never answered (don’t think I do not notice), but instead reacted to Fair Witness’s related question about poor Design:

    Well, no, you did NOT answer my objection, not even after me calling your attention to it a second time. What you did do was suggesting for the second time that mutations are inconsequential for evolution because they are taken care of by DNA repair mechanisms.

    So, for the third time:

    1) Do you agree that polymerase proofreading and DNA repair mechanisms cannot prevent mutations from happening, not even in species that are able to drink vegetable smoothies on a regular basis?

    2) If we can agree that mutations are continuously entering populations of organisms; Then what is stopping them from accumulating?

    Your kill shot is a dud.

    1) High mutation rates doesn’t do what you think it does. A high mutation rate is not evidence for lack of design. In fact, it is the opposite. Despite best efforts to prevent mutations, our bodies can’t deal with them all for reasons I already stated. However, the fact that the integrity of genomes is maintained speaks volumes about the robustness of biologicals systems. Furthermore, a high mutation rate in an undesigned system would crash and burn in a heartbeat.

    2) STFW?! Of all the mutations, how many were prevented? You have no friggin’ idea. You are making the unwarranted assumption that because the mutation rate must be astronomically higher that the number of blocked mutations therefore no design.

    Your objection is noted and debunked.

  35. Aaaaah, you meant defense against the environment. Sure. And what particular environmental threat did you have in mind? If some nook of the prebiotic environment was conducive to the assembly of a cell (say a lipid vesicle containing some biopolymers) why would decomposition suddenly outweigh self assembly and biosynthesis?

    Densities in den cities. Wait, what? a lipid vesicle containing biopolypers self-assembled? How did you arrive at that non-teleological conclusion? what makes you think what you describe now as self-assembly had to have happened in the early biosphere. According to your evolutionary narrative, for all we know it what a just a chance confluence of environmental factors that so happened to bring various chemicals together. Self assembly never enters the picture. Too early for that. So any fortuitous congregation of chemicals would by definition be highly fragile. So yeah, the likelihood that that first lucky assembly of chemicals without any bells and whistles to hold it together let alone replicate would disintegrate quickly is extremely likely.

    I also love how you are talking about THE proto-cell. It appears to be quite hard for creationists to detach themselves from the idea of a single ancestor (male, of course). It is quite unlikely however that, given that a favorable environment existed, it gave rise to a *single* lipid vesicle that started the whole show.

    What makes you think that a favorable environment would give rise to even a single lipid vesicle by chance, let alone several. You are laying on the evolutionary storytelling rather thick, wouldn’t you say?

    Upthread, DNA_Jock mocked the “Twas ever thus” attitude of many creationists. Let me assure you that you too are well deserving of this epiphet. Please, try to wrap your head around the fact that four billion years ago things were very different.

    Ha, a typical liberal, faux-skeptical, evolutionist’s cheap rhetorical trick – accusing others of what they are guilty of. Indeed, the environmental conditions billions of years ago were different that today and in fact very inhospitable to life. That environment is not friendly to your evolutionary narrative.

    Keep crackin’ tho.

  36. Robin: My emphasis. Once again, as I noted, Steve, et al, toss out the same insistence that such folk have used for 20 plus years: they insist there’s some magic, impenetrable barrier to what system interactions can produce. On one side are emergent properties and functions that they can somewhat wrap their heads around and agree occur and on the other side…well…there can be no other side because of the magic barrier. Oddly, they can never define the barrier at any level – not at the quantum mechanical level, atomic level, molecular level, system level, chemical level, nothing.

    So, what is the barrier and what makes it impenetrable? Without that, we’re back to the old acknowledgements that a) “creationists don’t understand science” and b) “creationists are unable to define reality”

    The barrier is information.

    You all talk a good game once all the information is in place.

    I have yet to hear a non-storytelling evolutionary explanation of how information came into being in biological systems.

    Talk about magic pixie dust. Chemicals crashed into each other repeatedly and then after a time…Boom! information was created and then emergent properties ascended the throne and and started commanding the nether world.

    Arise and move, you stupid bastards! Something like that anyway, right?

  37. Alan Fox:
    CharlieM: In order for you to form all these beliefs you hold the concepts you are using must enter your consciousness.

    Alan Fox: “Enter my consciousness” means what? That I need to be aware and think about them? What else? Anything else?

    It means you become aware, the thinking ego that is you becomes aware. Your senses aren’t aware, your brain is not aware, you are aware.

    You have a direct experience of your thoughts, you don’t have a direct experience of your brain matter, unless your skull has been opened up that is.

  38. Fair Witness:
    CharlieM: To think that achieving perfect copying fidelity is optimal is a very anthropomorphic way of looking at processes. That may be okay for books or pc programs but there is an integral wisdom that ensures life is much more dynamic than perfect copying would allow.

    Any engineer will tell you that a perfect fit is sometimes the last thing that is needed.

    Have you ever thought that it possible you are failing to see the bigger picture?

    Fair Witness: I am an electrical engineer, and a software engineer.

    I am aware that sometimes looser-than-perfect tolerances are needed for physical parts to work well together; that is not what we are talking about with copying of a genome from one generation to another.

    Then have you ever wondered why higher organisms have mechanisms in place to ensure that perfect copying does not take place from one generation to the next? Perfect copying is detrimental to the evolutionary process.

    Fair Witness: For “front-loading” of all the genomes to work across 4 billion years, it would require perfect fidelity in the copying process. We know that the copying process in biological organisms is far from perfect. In humans we see 80-120 errors per generation.

    By reductio ad absurdum, front-loading cannot be what is happening.

    I am also aware that an engineer should not be making assertions about biology without checking with biologists or geneticists, so if anyone in those fields can see problems with my logic, please correct me.

    Your idea of front loading is fixated on the DNA molecule. But the DNA itself is not the source of creativity. It is the processes through which the DNA is acted upon that create the variety.

    I have never used the term, “front loading”. What I would say is that all life with the potential to develop further but that potential diminishes as forms lose their plasticity. Plant life in general consumes its resources in the processes of growth. Animal life curtails its growth forces and this allows for the potential to develop nervous systems which are the seat of consciousness.

  39. Alan Fox:
    CharlieM: In order for you to form all these beliefs you hold the concepts you are using must enter your consciousness.

    Alan Fox: “Enter my consciousness” means what? That I need to be aware and think about them? What else? Anything else?

    Charlie:
    It means you become aware, the thinking ego that is you becomes aware. Your senses aren’t aware, your brain is not aware, you are aware.

    You have a direct experience of your thoughts, you don’t have a direct experience of your brain matter, unless your skull has been opened up that is.

    As far as I can work out, you seem to be agreeing, that “awareness” (which I equate with neural activity) and “consciousness” are synonymous.

    But “Your senses aren’t aware, your brain is not aware, you are aware” doesn’t make enough sense to me to either agree or disagree with it. My awareness is me and resides in my brain, I am what my brain does. When my brain dies, I die. I agree that awareness is not “the senses” but the sensory information from impinging on and interacting with the environment (not excluding vicariously in gleaning experience of others directly in conversation and indirectly via stored information) is an essential part of the neural activity forming the awareness in my brain that is me. I and my awareness are me.

  40. Alan Fox:

    CharlieM: How do you know you drive the car?

    Alan Fox: Because I am aware of the process. It can be scary for others but I quite enjoy it.

    Thinking about how we drive can help us think about levels of consciousness. If you become used to taking a regular route, you can reach your destination without being aware of any part of the trip, possibly with your mind on other things as you drive. But you can decide to pay attention to your actions during the trip and you will remember much of it. Through concentration we can enhance our consciousness.

    CharlieM: How do you know it doesn’t read your mind and take you to where you desire to go?

    Alan Fox: That’s a much less parsimonious hypothesis with no mechanism. How could we test it?

    Exactly. You thought about the options, reached a logical conclusion, and you were surely aware of your thinking. Thus demonstrating that you are conscious.

    Alan Fox: There’s actually a serious point we are all up against in that self-analysis is doomed to failure by the simple fact that no sentient entity can understand anything as complex as itself.

    In order to understand ourselves in our essential nature. we don’t need to know each and every molecule that passes through us, or know the precise position and composition of all our bodily organs. We may not reach a point of full understanding but it is something to aspire towards.

  41. Steve: Your kill shot is a dud.

    1) High mutation rates doesn’t do what you think it does. A high mutation rate is not evidence for lack of design. In fact, it is the opposite. Despite best efforts to prevent mutations, our bodies can’t deal with them all for reasons I already stated. However, the fact that the integrity of genomes is maintained speaks volumes about the robustness of biologicals systems. Furthermore, a high mutation rate in an undesigned system would crash and burn in a heartbeat.

    2) STFW?! Of all the mutations, how many were prevented? You have no friggin’ idea. You are making the unwarranted assumption that because the mutation rate must be astronomically higher that the number of blocked mutations therefore no design.

    Your objection is noted and debunked.

    Thank you for your considered and detailed answer. It’s a real shame it doesn’t actually have anything to do with my “objection”.

    For clarity: the objection that a high mutation rate is inconsistent with good Design is NOT mine; That was a remark by Fair Witness. I agree with you that a high mutation rate is not neccesarily an argument against Design, unless you commit to the position that Design of organisms entails high fidelity of replication (which would make the most sense given your previous comments, but let’s not go down that particular rabbit hole).

    But non-zero mutation rates do strongly contradict your claim that evolution no longer occurs, i.e. that modern species / kinds are immutable. When a population is accumulating mutations it is in fact evolving. Hence, to salvage your claim that evolution is no longer occurring, you need a mechanism that selectively removes newly introduced mutant alleles. So encore: what is stopping mutations from accumulating?

  42. Steve: According to your evolutionary narrative, for all we know it what a just a chance confluence of environmental factors that so happened to bring various chemicals together. Self assembly never enters the picture. Too early for that. So any fortuitous congregation of chemicals would by definition be highly fragile. So yeah, the likelihood that that first lucky assembly of chemicals without any bells and whistles to hold it together let alone replicate would disintegrate quickly is extremely likely.

    And so we went from “the first cell cannot possibly survive” to “the first cell cannot possibly come into being”. Do you actually have anything to offer in support besides a carefully tended ignorance of the relevant literature and a royal helping of personal incredulity? I am especially interested in your claim that it was “too early” for self assembly. Chemistry was different then, I guess.

    Steve: What makes you think that a favorable environment would give rise to even a single lipid vesicle by chance, let alone several.

    Because it has been demonstrated that certain amphiphilic compounds which are suspected to have been available on early earth, such as short-chain fatty acids, can in fact self-assemble into stable vesicles.

    Steve: Ha, a typical liberal, faux-skeptical, evolutionist’s cheap rhetorical trick – accusing others of what they are guilty of. Indeed, the environmental conditions billions of years ago were different that today and in fact very inhospitable to life. That environment is not friendly to your evolutionary narrative.

    Teehee. You mean inhospitable to most modern life, don’t you?

  43. Steve: The barrier is information.

    This does not follow.

    If Na and Cl come together and table salt, with all its new properties, arises, why isn’t this “information”, whatever that is, preventing that emergence? Where does this supposed “information barrier” come into play given that it clearly isn’t a barrier to things like ant colonies, tv screen color, and table salt?

    You all talk a good game once all the information is in place.

    What “information” is “in place” in the case of Na, Cl, and the resulting table salt?

    I have yet to hear a non-storytelling evolutionary explanation of how information came into being in biological systems.

    Well…we weren’t discussing biological systems. We (well…at least I) were discussing the impenetrable barrier between some acceptable emergent properties and in your words, “the intractable consciousness, intent, purpose problem”. You’ve tossed out “information” as the barrier, but you haven’t presented what this supposed “information” is and why it’s a barrier to the “intractable consciousness, intent, and purpose problem”, but not a barrier to Na and Cl emerging as table salt.

    Talk about magic pixie dust.Chemicals crashed into each other repeatedly and then after a time…Boom! information was created and then emergent properties ascended the throne and and started commanding the nether world.

    Arise and move, you stupid bastards! Something like that anyway, right?

    Yawn…atoms, molecules, and chemical interactions are not analogous to billiard balls. So your scenario above is a strawman at best.

    Are you really suggesting that sodium and chloride first need some sort of front loaded information before they can combine and table salt emerges? And if not, why do you insist that there’s an information barrier for other chemical reactions?

  44. CharlieM: … Perfect copying is detrimental to the evolutionary process…

    Exactly !

    Please explain that to Steve. He is not listening to the rest of us.

    We do not observe the perfect copying that front-loading would require.

  45. Robin,

    Ah, but you’re forgetting that life has information inside of it, and chemistry cannot generate information because reasons.

  46. Steve:.. it make sense that the error correction rate in the past was lower.

    Lower, perhaps, but preserving all the front-loaded information would require a ZERO error rate, which we never observe.

  47. Fair Witness: Lower, perhaps, but preserving all the front-loaded information would require a ZERO error rate, which we never observe.

    So much the worse for observations, then.

    After all, CharlieM believes that the archetypal forms exist in a non-physical, supersensible dimension of reality — they just rolled out onto into perceptible, material reality every once in a while.

    Steve believes something quite similar — the designs are already fully existent, in the mind of the Designer, and It just decides when it’s time for the new designs to get implemented, and then It creates the genetic information necessary for doing so.

    If this seems a bit daft to you, bear in mind that they are absolutely certain that chemical rearrangements cannot lead to the kind of information that would guide the development of adaptive traits. As they see it, we have never observed that happening, so it is illegitimate to posit it in scientific explanations. But they do think that intelligent minds (e.g. ours) can create new information, which is why they think that Design is a far superior explanation than what they think we have to rely on, which is mere randomness.

  48. Kantian Naturalist: So much the worse for observations, then….

    Indeed. I can certainly understand being seduced by living in the map , which you can redraw to your heart’s content. rather than the territory , which does not abide by one’s fanciful wishes.

    As an engineer, I spend a lot of time dreaming up designs, living in the map. But then I have to build something real and test it. The universe has the final say. This constantly reminds me just how inaccurate a map can be when you spend too much time there.

Leave a Reply