The Blind Watch Dropper

Here is one of the more essays I wrote based on discussions I’ve had hereon and on other sites like Pandas Thumb. I think this is one of the more appropriate essays for discussions here and it also happens to be one I feel is fully finished at this point. Well…I’m happy with it, but clearly I may edit it a bit given constructive criticism… 🙂

______________________________

I haven’t seen much press on this lately, but back in the late 1980s, Creationists – a slice of Christians who hold that the creation of the universe, Earth, and all living things on Earth were created by God exactly as described in the Christian Bible and that the Earth is roughly 10,000 years old…tops – tried an end around to the 1987 Supreme Court decision (Edwards v. Aguillard) barring the teaching of Creation Science in public schools. The attempted end-around was called Intelligent Design (ID).

ID, boiled down, is essentially a dressed up version of William Paley’s The Watch and The Watchmaker argument for the existence of God, or rather, a slightly gussied up Teleological Argument for the Existence of God. Paley’s argument goes like this: if you stumble upon a rock in the woods, you could reasonably surmise that it had been there, in that state, forever (keep in mind that Paley wrote his analogy in 1802 and was not familiar with what we now know about geology and in particular plate tectonics and erosion and similar forces. So, he can be forgiven for thinking that some items of the universe (like planets and stars) and the Earth (like soil, rocks, mountains, rivers, land masses, and so forth) exist unchanged forever) as a simple object of nature. By contrast, if you stumble upon a watch, you would not think that this item had been there forever, but rather you’d likely think that this item reflected the intent of a creator and, in particular given its complex parts working in intricate harmony, functions specifically for a purpose the creator designed it for. Given this, by analogy one can reasonably look at the universe and, seeing its complex interactions working in intricate harmony, infer it too must be designed and conclude, therefore, there is an ultimate Designer.

All Teleological Arguments rely on the same basic argument: certain features and functions of the world exhibit complexity that appears far too harmonious and intricate to have occurred by accident and thus must have been intelligently designed. Ergo…God.

It’s helpful to understand a bit about the history and use of the concept to better understand the application of teleology in theology, but it’s not absolutely necessary. That said, here are a definition and a brief summary:

Teleology comes from the Greek telos, meaning end (as in goal or purpose), and logos, meaning reason. So, teleology is about understanding the purpose of things. In its most basic form, teleology is the study of the purpose that phenomena serve rather than the cause by which they arise in order to provide an explanation for the phenomena. In other words, teleologists hold that the purpose for the sky being blue is more useful in understanding aspects of the world than studying and understanding optics and the Rayleigh Diffusion Effect. I admit, I’ve had no luck digging up a teleological explanation for the sky being blue, but apparently there used to be some popular ones back before modern science’s explanations. The point is, teleology attempts to address ‘why’ things occur, as opposed to scientific approaches that attempt to answer ‘how’ things occur. It’s also worth understanding that teleology, particularly as popularized by Aristotle and Plato in their day, was a reflection by analogy of the fact that nearly all human endeavors are goal-oriented and purpose driven. Thus by analogy, Aristotle saw the universe as rational and purposeful – analogous to human rational and purposeful behavior – and thus felt that all phenomena can only fully be understood when one considers and appreciates the purpose of the various phenomena.

There are a number of issues I have with teleological arguments and perspectives, but I’m going to focus on four main issues here.

First and foremost, technically there is no actual argument in the teleological approach to the existence of God as it’s simply a tautology and thus question begging. If your philosophy’s premise assumes that all things have purpose and goals, using that philosophy to argue for a goal-oriented and purpose-creating designer is simply restating your premise’s assumptions. It’s just arguing in a circle. Intelligent Design tries to dress the argument up a bit by focusing on complexity vs purpose and goals, but the issue remains the same. In ID, the argument is changed slightly to certain biological and informational features of living things are too complex to be the result of natural selection (or natural processes) and therefore must be the result of intentional and rational (intelligent) design requiring an intelligent designer. This, of course, suffers from the same tautological issue noted above: the first premise of ID is that living things are too complex to be the product of natural processes, but if the premise is that living things can’t come about from natural processes, what’s left? By premising that living things can’t be the product of natural processes, the premise implies something other than natural processes – i.e. design processes. To then conclude a designer is simply restating the premise. Yet again, a tautology.

Next, there’s the fallacy of the General Rule. The fallacy of the General Rule is a logical fallacy wherein someone assumes that something in general is true in all possible cases. A standard example is the claim that “all chairs have four legs”. But clearly rocking chairs have either no legs or two legs, depending on the design, and there are plenty of modern chair designs with three legs, and not a few bar stools that are essentially held up on a single pole. In the case of ID, the assumption is that complexity implies design and since biological objects are complex they must be designed. The thing is though, not all designed things – well, human designed things – are complex. Consider toothpicks, paper clips, floss, and Popsicle sticks as but a few examples. These objects are never used in teleological arguments for obvious reasons. And while it’s certainly possible that a toothpick could come about through natural processes, we know a human-designed toothpick when we see it and not because of the harmonious workings of its complex parts. No, it’s because of two things: man-made toothpicks have tell-tale evidence of being manufactured and they exist in greater collected numbers than nature could reasonably produce.

Another issue with ID that is related to the fallacy of the General Rule noted above is that it relies upon a false dichotomy. A false dichotomy is a logical fallacy wherein someone argues that some condition has only two alternatives when in fact there are more. An example would be someone who insists that the only alternative to driving a car is walking when clearly bicycles, skateboards, pogo sticks, and air travel all exist. In the case of ID, even if one were to agree that most, if not all, living organisms are too complex to have come about through evolutionary processes, it’s questionable at best whether a designer (and specifically God) is the only alternative. There are abundant natural processes that lead to complex organized structures (think snowflakes, tree rings, and the Giant’s Causeway). And even if we grant a necessitated designer, since there’s no way to assess or know anything about the supposed designer inferred by ID, the designer could very well be invisible pink unicorns or aliens. The bottom line is that it’s a rather large (and unrealistic) stretch to assume the only way to get biological complexity is either evolution or God.

Lastly, as noted above, we don’t infer design from complexity so much as we infer design from indications of manufacturing. This, for me, the primary failure of all forms of teleological arguments for the existence of God and ID in particular.  Designs are a very specific form of plan and planning. We make designs (usually written and drawn) to help us visualize how various components and processes will interact and work in a given environment in order to (hopefully) highlight problems and issues before we actually manufacture the object of design. So the truth is that looking at an object tells one very little about the actual activity that went into designing that object. And while looking at an object can indicate something about whether the object was designed, it’s really the indications that the object was manufactured through some tool use process that provides that inference. Manufacturing leaves evidence; design does not.

I’ve never found the ID arguments for the design of biological organisms all that compelling for a number of reasons. The dubious math, the fallacious arguments, the disingenuous bait and switch to Christian apologetics, and so forth. But even beyond that, there was something about the objects in nature – organisms themselves – that just don’t seem designed to me. There is something different about them compared to man-made objects, but I was not able to put my finger on what I felt the difference was. And then it hit me one night: replaceable parts.

All man-made objects – every single one – are either designed specifically to be replaced or have components that are designed specifically to be replaced. Why? Because tool users and manufacturers learn really quick that tools and/or certain parts of tools wear out. So as designers, we anticipate the need for maintenance.

No such anticipation or planning for maintenance can be found in nature. None. If something breaks in an organism, either that organism learns to live without it or it dies. Or, in the case of humans, that part gets replaced by human designed or human configured replacements (as in my case). But even in the later case, humans have to create a work-around, because biological parts actual resist being replaced. You can’t just replace human parts with other human parts willy-nilly. In most cases, the new parts just won’t work, or worse, they’ll be rejected by the body’s immune system. But of particular note, there’s no surplus of replacement parts anywhere; no storage unit somewhere with a bunch of eyes or hearts or toes or hair or kidneys or…anything. Not even bark or leaves or antennae or scales. Nothing.

Of course, this makes perfect sense given evolution and other similar natural processes. It makes no sense if there were an actual designer, particularly an omni-god Designer, behind it all.

601 thoughts on “The Blind Watch Dropper”

  1. “Toward a Thought-Full Teleology” ia a talk by Stephen L. Talbot. The transcript of the video can be found here

    He claims the problem with modern biological science is an “entrenched Cartesian dualism” and he goes on to make four “bald assertions” when dealing with teleology. Orthodox modern biology is caught up in an inner and an outer dualism and puts too much faith in natural selection.

    First there no break between the thoughts and intentions of the human actor and bodily processes down to the subcellular level

    Secondly he discusses the relationship between the consciousness and unconsciousness. The very porous boundary between the conscious and the unconscious.

    Thirdly possessing and being possessed by consciousness are two very different things. Acting on instinct is an example of being possessed by consciousness.

    He references Owen Barfield:

    The philologist Owen Barfield, a student of the evolution of consciousness, had in mind this distinction between possessing and being possessed by consciousness when he said that we humans had first to be spoken by language before we could become conscious of that language and make it “our own”. Peering back toward the prehistoric age of myth, he (Barfield) wrote:

    “it was not man who made the myths but the myths, or the archetypal substance they reveal, which made man. We shall have to come, I am sure, to think of the archetypal element in myth in terms of the wind that breathed through the harp-strings of individual brains and nerves and fluids … ” (Barfield 1977, p. 75)
    I did warn you about outrage! But before you succumb to that reaction, you might want to ask yourself: Where, without the Cartesian influence, would the outrage lie? Is there any reason, in light of all the foregoing, not to recognize in our reflective intelligence an internalization, a conscious possessing, of some part of the intelligence that formed, and continues to inform, our physical bodies?

    His fourth bold assertion is to do with being and becoming.

    And he finishes off with a few thoughts on the nature of human freedom.

    Time for me to watch it again, even if most here do not give it a second thought. 🙂

  2. Steve:
    Well, people can enjoy vistas, just not all people. But why must it be that all vistas should be enjoyed by all people. some people will enjoy vistas and some will enjoy newspaper print.

    There are a number of issues I have with your argument. First, you seem to playing rather fast and loose (and arbitrary) with what you mean by “purpose”. In human-made items and engineering, an item’s “purpose” is generally the only thing that item is used for. Fingernail clippers’ purpose is to trim finger (and possibly toe) nails. I suppose one could technically use fingernail clippers as a wedge for a short table leg, but would that then be considered their “purpose”?

    Vistas are seen by but a fraction of humanity, so it strikes me as absurd to even consider them having some humancentric aesthetic purpose. So to me, your labels of purpose seem to be the result of fallacious thinking such as false dichotomy, confusing causality with correlation, selective observation, post hoc ergo propter hoc, least plausible hypothesis, affirming the consequent, special pleading, and so forth. The fact is, vistas could have a variety of purposes or no purpose at all. There’s simply no way to reasonably, validly, or rationally establish what, if any, purpose vistas have. Applying any supposed purpose to vistas is simply arbitrary.

    Likewise, chocolate may help non-diabetic libidos but diabetics can enjoy the blue pill.Everybody wins!

    Purpose, like quality is undefeated.

    Just to correct your understanding a bit here, chocolate is show to produce an endorphin rush in some people. An endorphin rush is not an increase in libido; the endorphin rush some people get from chocolate is similar to the type of endorphin rush some people get from sex, but it is not accurate to say that chocolate increases libido. And since blue pills only work on men, you seem to be completely missing the point (hint: chocolate releases endorphins in both some men and women).

    The point is of course that your argument for purpose in the world does not appear to be very logical.

    ETA: to illustrate the absurdity of trying to assess purpose in nature, consider the reasonableness of claiming that clearly some god created humans with noses and ears for the expressed purpose of holding eyeglasses on our faces…

  3. Steve
    …I do believe that life had a starter kit that enabled variation.Attributes, characteristics, skills etc were pre-determined. That is actually what evolution means; a rolling out (of pre-determined parameters)…

    You must be a follower of Perry Marshall and his Evolution 2.0. He believes that all of life’s variety was front-loaded into DNA from the start.

  4. CharlieM,

    Thanks for sharing the video and transcript from Talbott. It sounds like he took my advice to read Hans Jonas.

  5. Robin,

    Thank you for sharing your motivations for writing these essays. I’m enjoying reading them, and our interactions, so please continue!

  6. Kantian Naturalist: Whereas for people trained in biology (even if only at the undergrad level, like myself) organisms do not even appear to be designed, so there’s we don’t see the same phenomena as needing to be explained.

    What in the world…

  7. Flint: The problem with imaginary cheetah features like horns and wings and venom (but not skin color – cheetahs have evolved effective camouflage) is, species have no control over the sorts of variation provided by mutation. What does not occur cannot be selected.

    Ok, so cheetahs have camouflage. And you think first we had to have all sorts of patterns and colors that DIDN’T provide camouflage at all, because we are taking the random chaotic walk of evolution, right? So then we should defintely expected some to end up blue and some to end up candy striped right?

    Of course, according to you, those varieties weren’t very successful, but there were some right? Maybe buried in some permafrost somewhere?

    But then you throw in, what doesn’t occur can’t be selected. So we are now supposed to believe that it just so happens that in cheetahs only camouflaged colors occured and in dolphins only blue colors occured, so we won’t find the camouflaged dolphins either? What luck!

  8. Kantian Naturalist: I guess my own view is this — rather than coin a new term (“teleonomy”) because teleology has been tainted by theologians, I’d rather reclaim teleology for doing what Aristotle used it to do: describing and explaining the behavior of plants and animals.

    Oh that’s what you are doing is it? You are using teleology to explain what plants and animals do? I am glad you made that clear, because I don’t have a clue what you are calling teleology. Its almost as if you are intentionally making the term of teleology as obfuscated and meaningless as possible.

    So please do tell, if what animals and plants do is teleological, what about buildings that collapse and food that rots, and sand that blows, is that teleological as well? Because its what they do. If what something does is teleolgical simply because it is what they do, why in the world would any of these things be any different? Because they have a mechanical brain? If none of this is an advanced plan, then there is no difference whatsoever, and your concept of teleology is as muddied as it could possibly be.

    That’s how you are reclaiming it? I know you love ancient texts, but maybe you can explain the difference “teleologically” between a building collpasing and what “animals do” without invoking someone from the 5th century B.C. Is that possible?

  9. phoodoo: Ok, so cheetahs have camouflage.And you think first we had to have all sorts of patterns and colors that DIDN’T provide camouflage at all, because we are taking the random chaotic walk of evolution, right?So then we should defintely expected some to end up blue and some to end up candy striped right?

    Of course, according to you, those varieties weren’t very successful, but there were some right?Maybe buried in some permafrost somewhere?

    But then you throw in, what doesn’t occur can’t be selected.So we are now supposed to believe that it just so happens that in cheetahs only camouflaged colors occured and in dolphins only blue colors occured, so we won’t find the camouflaged dolphins either?What luck!

    I’m really not getting what you’re going on about, Phoodoo. For one thing, you do know that there are roughly ten different color/pattern cheetah variants out there, right? Look up “normal cheetah” and then check out…say…”maltese cheetah” and “king cheetah” (my personal fav, and I’ve actually gotten to pet one of them! Woot!) and “Isabelline cheetah” and…oh yeah…”chinchilla cheetah” that is…waaaait for it! BLUE! Now, they are ridiculously rare, but show up as color mutation every once in a blue (heh heh!) moon, so I’m not sure what your complaint is.

    And given the variations that do indeed crop up, there’s no reason to think that other variations (something like a candy stripe) given their relationship to other striped cats in their ancestry could have shown up too. So what’s the issue?

    Oh…and as for dolphins, they come in variety of colors too: black, gray, blue, two-tone, three-tone, white, pink, spotted, splotched, melanistic, albino…

    And yeah, statistically a number of these variations are not, statistically speaking, as successful at surviving and producing as many offspring. Ergo, the more successful color/camo variants tend to be waaay more common. Eventually, it’s very likely certain less successful variants are just going to disappear. It happens.

  10. Kantian Naturalist: Thanks for sharing the video and transcript from Talbott. It sounds like he took my advice to read Hans Jonas.

    I hope you enjoyed watching/reading it.

    I don’t know how much of Hans Jonas he has read. But I do wonder what he would have taken from Jonas that he hasn’t already received from the inspiration of Steiner and anthroposophy, or that had not already aligned with his views.

    Do you have anything specific in mind?

  11. Regarding individual traits such as animal camouflage I think it’s a mistake to try to understand the appearance of such in isolation. They must be considered in relation to the animal as a whole, especially its habits and lifestyle. In my opinion groups of animals such as species, particularly in higher animals, have characteristics that are largely determined by a shared feeling and willing life as well as environmental restraints.

  12. Here Steiner compares Goethe’s understanding of nature compared to that of Kant.

    Understanding is possible for us only in the case where concept and individual thing are separated, where the concept represents something general, and the individual thing represents something particular. Thus there is nothing left us but to base our observations about organisms upon the idea of purposefulness: to treat living beings as though a system of intentions underlay their manifestation. Thus Kant has here established non-science scientifically, as it were.

    According to Kant we cannot understand the living world in the same way that we can understand inorganic nature.

    Steiner continues:

    Now Goethe protested vigorously against such unscientific conduct. He could never see why our thinking should not also be adequate to ask where an organ of a living being originates instead of what purpose it serves. Something in his nature always moved him to see every being in its inner completeness. It seemed to him an unscientific way of looking at things to bother only about the outer purposefulness of an organ, i.e., about its use for something other than itself What should that have to do with the inner being of a thing? The point for him is never what purpose something serves but always how it develops. He does not want to consider an object as a thing complete in itself but rather in its becoming, so that he might know its origins. He was particularly drawn to Spinoza through the fact that Spinoza did not credit organs and organisms with outer purposefullness. For the activity of knowing the organic world, Goethe demanded a method that was scientific in exactly the same sense as the method we apply to the inorganic world.

    We cannot simply treat the organic world in the same way we deal with the inorganic realm. There is an inwardness to living nature that transcends mechanics and the science of life must conform to this difference. The laws of the living world are not the same as the laws of physics.

    Goethe’s understanding of the archetype is the equivalent of Newton’s laws in the inorganic realm.

  13. Steve: You seem to be having trouble with the word purpose or perhaps you are being intentionally obtuse.

    Or perhaps you suck at explaining yourself 😜

    Steve: All animals are either predator or prey. A meta-design does not require that specific predators are matched to specific prey and visa-versa. The attributes and characteristics of each animal will sort themselves out as to which is which.

    Are you seriously suggesting that the morphology and behaviour of gazelles does not show specific adaptations for escaping large pursuit predators?

    BTW Are you comfy in your hole? Deep already isn’t it?

    Steve: I said why do roses need thorns? Didn’t their previous adaptation work? If it didn’t work, how did they survive waiting for their upgrade?

    Morton’s demon is strong in this one. Again: Please read my reply to phoodoo who made a similar comment.

    Steve: I support the idea that God did create the earth just like the Bible said. Weather system first, plants next, then birds, then creepy, crawly things, then mammals.

    Thanks for that. I have trouble understanding your position though: it appears to be a mixture between special creation and front-loading. Could you tell us whether you believe species/kinds to be immutable or do you allow for diversification within kinds?

  14. CharlieM,

    I was thinking primarily of Talbott’s criticism of cybernetics:

    If you’re thinking, “Well, a cruise missile is surely goal-directed, and corrects its course using feedback”, then I am afraid you are taking the engineer’s point of view, not the machine’s. Yes, the human-imposed design is purposive, and will be reflected in the machine’s performance, so long as it is working well. But variance in the functioning of the parts, which include the feedback mechanisms, will have a very different effect compared to the dramatic variances a cell and organism can tolerate for example in its gene expression networks. That’s because the missile’s apparent intentions are not immanent in the machine itself.

    This is pretty much the same criticism that Hans Jonas makes about why cybernetics cannot naturalize teleology. (See A Critique of Cybernetics.) And like Talbott, Jonas thinks that what sets apart genuine teleology from any artificial simulation is that the former has interiority or inwardness.

    I know from email exchanges with Talbott that his most fundamental inspiration is Coleridge and the Romantic Naturphilosophie that he brought to English arts and letters at the dawn of the 19th century. There’s a good deal of Goethe in that tradition, but of course much else besides.

    CharlieM: According to Kant we cannot understand the living world in the same way that we can understand inorganic nature.

    That’s mostly right, but in a way, it’s worse: Kant’s arguments entail that biology as an empirical science isn’t really possible.

    Kant recognizes that we cannot help but experience organisms as self-determining systems: they are the cause of themselves (tree –> acorn –> tree), the whole determines the parts, each part contributes to the needs of the whole.

    But he also cannot quite free himself of the idea that purposiveness is the result of the conscious intentions of a designer, and that idea has no legitimate place in science.

    As a consequence, Kant concludes that while we cannot help but experience organisms as teleological, that’s a fact about us, about the structure of our minds, and not a fact about organisms — and definitely not the basis of an empirical science.

    CharlieM: We cannot simply treat the organic world in the same way we deal with the inorganic realm. There is an inwardness to living nature that transcends mechanics and the science of life must conform to this difference. The laws of the living world are not the same as the laws of physics.

    I think this conflates two very different things — teleology and subjectivity. I would say that our failures in getting clear about that distinction have hampered biology up to the present day.

    It is one thing to say that teleological explanations have a different schematic character than mechanistic explanations. (I would certainly accept that.) And it is a distinct but related thesis that we need teleological explanations in order to do organismal and supra-organismal biology. (I would accept that, too.)

    It is a quite different thesis to say that teleology can only be grasped ‘from the inside’, as it were: from the point of view of the purposive organism itself. (Jonas makes this move. So do many other bio-philosophers I respect. Nevertheless I consider it at best a non sequitur.)

  15. phoodoo: That’s how you are reclaiming it? I know you love ancient texts, but maybe you can explain the difference “teleologically” between a building collpasing and what “animals do” without invoking someone from the 5th century B.C. Is that possible?

    I did that here.

  16. Kantian Naturalist,

    Oh let’s see then- the reason we call what an animal does “teleological” and not a building collapsing is because, according to you

    The key idea is that biological systems are teleological by virtue of having a specific kind of organization in which interacting constraints collectively keep the system far from thermodynamic equilibrium while extracting energy and matter from the environment and converting that energy into work that is used to mitigate increases in entropy. This counts as intrinsic teleology,

    So, because they are far from thermodynamic equillibrium, what they do is teleological. Is that right?

    And you, (and Neil apparently, ha), don’t think this has obliterated any meaning of the term into oblivion, huh?

    Put aside the fact that when people talk about teleology in biology, they generally mean the concept as how it applies to the whole, and not the individual, in other words, thay aren’t talking about if someone reaches for a bottle of water is that intentional or thinking in terms of a goal, a target (which is the meaning of teleology-which you are bastardizing), they are generally talking about the development of life on the planet, but putting that aside, your claim that what plants and animals do is telelogical because “they are far from thermodynamic equillibrium” but not what wind does, and not what stars do, is really just trying to imply magic without using the term magic.

    Why would anyone think that being far from thermodynamic equillibrium produces targets, goals, but other laws of physics don’t? Just the particular ones that influence bags of chemicals do.

  17. Kantian Naturalist,

    I like this quote from the paper you referenced:

    “A candle flame […] makes several active contributions to its own persistence. It maintains above combustion threshold temperature. It vaporises wax into a continuing supply of fuel. In a standard atmosphere and gravitational field, it induces convection, which pulls in continuing oxygen and removes combustion products. A candle flame, in other words, tends to maintain itself; it exhibits self-maintenance”

    So animals, plants, and candle flames are teleological, but still not things that fall. Ok.

    And perhaps the water cycle, or perhaps not…

  18. Kantian Naturalist: But he also cannot quite free himself of the idea that purposiveness is the result of the conscious intentions of a designer, and that idea has no legitimate place in science.

    KN, can you clarify? I’m not sure when you say “that idea has no legitimate place in science” whether that was Kant’s view or yours.

    I’d nit-pick on whether conscious intent of a designer is a legitimate area of scientific research. If the putative designer is identifiable and registers physically in reality, has some attribute that can be measured, however indirectly, then why not?

    Of course the duplicity of the ID movement is in promoting “Intelligent Design” as an explanation (for something; what that is tends to vary) without any evidence or consensus on what, who, when, where, how. I give them a pass on “why” as that is unanswerable by anyone, inevitably leading to infinite regress.

  19. phoodoo: …candle flames are teleological…

    Steve was playing the same game wanting to play with words.

    I’ve long been puzzled by the lack of teleology in your comments. You’ve been posting here for years and some of your stuff has been witty and entertaining. At worst your mockery is mostly harmless.

    But what has been your goal or purpose here? Your aim, your intended outcome. I mean, I get that you don’t like evolutionary theory, you spend enough time attacking your strawman caricature often enough but to what end? Seems a bit random to me.

    That preamble turned into a bit of a rant, but thinking about candles and combustion and infinite regress, one can flit between geological and (what is the opposite of teleological) modes, and start with the physical and chemical properties of beeswax, tallow, cotton etc. One can question the motives of bees, bovines and cotton plants in producing the raw materials, one can examine the prehistory of humans interaction with fire and how (heh, but not why) heat and light are essential to human civilization, or one can consider the great designer incorporated everything into this designed universe.

  20. phoodoo: when people talk about teleology in biology, they generally mean the concept as how it applies to the whole, and not the individual, in other words, thay aren’t talking about if someone reaches for a bottle of water is that intentional or thinking in terms of a goal, a target (which is the meaning of teleology-which you are bastardizing

    I’m using the concept of teleology in the same way that Aristotle used it, and arguably he’s the philosopher who invented the idea in the first place. It was much later philosophers who used the idea to refer to the design or plan of the universe as a whole.

    In any event, I don’t consider myself beholden to “what most people mean” by a concept — I’m interested in truth, not consensus.

    phoodoo: Why would anyone think that being far from thermodynamic equillibrium produces targets, goals, but other laws of physics don’t?

    The idea is that teleology is an emergent phenomena: teleology emerges when far from equilibrium systems incorporate into themselves some of the enabling constraints that keep them far from equilibrium.

    phoodoo: So animals, plants, and candle flames are teleological, but still not things that fall. Ok.

    If you read more carefully in context, you will note that Mossio and Bich do not think that candle flames are teleological — they are self-maintaining but not self-determining.

    Granted, they are not as clear as they should have been on the difference between self-maintaining systems and self-determining systems. I’m writing a paper about that problem now.

    Alan Fox: KN, can you clarify? I’m not sure when you say “that idea has no legitimate place in science” whether that was Kant’s view or yours.

    It was Kant’s view, and he thought that because of his criticisms of the argument from design (what he called “the physicio-theological argument”)

    I’d nit-pick on whether conscious intent of a designer is a legitimate area of scientific research. If the putative designer is identifiable and registers physically in reality, has some attribute that can be measured, however indirectly, then why not?

    Sure, except that no one actually believes that. Despite the protestations of design proponents, the logic of their argument commits them to the existence of at least one non-physical intelligent agent.

  21. Kantian Naturalist: I’m using the concept of teleology in the same way that Aristotle used it, and arguably he’s the philosopher who invented the idea in the first place.

    You think that Aristotle was the first person to consider that life isn’t chaos, but rather appears purposeful? You think there has been a person alive ever who hasn’t noticed that?

    The central question of teleology that has been following mankind forever is whether or not it is just a convenient way to talk of life, or whether there is actually a plan. THAT is the crux of teleogy. As I said, you always want to revert to what one individual from 2000 years ago might have meant, when virtually everyone who ponders life since the beginning of time has been wondering. Is life plannned, or is it just chaos that looks planned-just physics that looks like it was always meant to be that way. The materialist would say that it could have and still may happen 1 of a million different ways-there was never a plan, but physics sometimes does weird things. Whereas the “skeptic” I would call it, but others may call it the immaterialist, or the religionist, if you prefer, would say we have to acknowledge that there is too much there to be a coincedence of mindless forces.

    Instead of tackling this obvious question, you argue that Mossio and Bich don’t neccesarrily think a candle is teleological, or the cycle of water, could be but no, because, because, yadda, yadda, … Because nothing. Right, you don’t care what the consensus is, you care about truth, but you think it matters more than a hill of beans if Mosio and Birch think a candle is teleological.

    Kantian Naturalist: The idea is that teleology is an emergent phenomena

    Emergent is an emergent phenomena that occurs when people create a new word for magic, and the new word becomes magic, which then shows that magic can come from magic. People who don’t believe in magic love emergence.

  22. I think you misunderstood my comment. You were arguing against purpose in vistas and chocolate. I was responding to your faulty logic in defense of their lack of purpose.

    To be sure, it does not follow that because some people are near-sighted therefore vistas have no purpose. Likewise, the fact that there are diabetics that should stay away from chocolate does not mean that chocolate has no purpose.

    Here I will make a defense of vistas and chocolate as having purpose.

    The design of the earth makes for eye-dropping scenery. Why should any person have a reaction to a vista, have any sense of beauty swimming in their brains? Does beautiful scenery impact our species survivability? Not in the least. Brute strength is all that is necessary. Get, eat, reproduce, repeat.

    Vistas speak to beauty which can be said to be synonymous with quality. The purpose of beautiful scenery is to provide a quality experience. Otherwise, humans would not have a faculty to recognise beauty. It can also be said that vistas create a sense of awe in humans that will encourage good stewardship of the land. A lota lota purpose in that.

    Chocolate is obviously purposeful like any foodstuff. Chocolate was invented as a drink and mixed with chili, vanilla, and other spices. So since its inception it seems to have been created as a feel good consumable. How is there not purpose in that?

    Anything that is created will exhibit purpose, whether intrinsic or extrinsic.

    Robin: There are a number of issues I have with your argument. First, you seem to playing rather fast and loose (and arbitrary) with what you mean by “purpose”. In human-made items and engineering, an item’s “purpose” is generally the only thing that item is used for. Fingernail clippers’ purpose is to trim finger (and possibly toe) nails. I suppose one could technically use fingernail clippers as a wedge for a short table leg, but would that then be considered their “purpose”?

    Vistas are seen by but a fraction of humanity, so it strikes me as absurd to even consider them having some humancentric aesthetic purpose. So to me, your labels of purpose seem to be the result of fallacious thinking such as false dichotomy, confusing causality with correlation, selective observation, post hoc ergo propter hoc, least plausible hypothesis, affirming the consequent, special pleading, and so forth. The fact is, vistas could have a variety of purposes or no purpose at all. There’s simply no way to reasonably, validly, or rationally establish what, if any, purpose vistas have. Applying any supposed purpose to vistas is simply arbitrary.

    Just to correct your understanding a bit here, chocolate is show to produce an endorphin rush in some people. An endorphin rush is not an increase in libido; the endorphin rush some people get from chocolate is similar to the type of endorphin rush some people get from sex, but it is not accurate to say that chocolate increases libido. And since blue pills only work on men, you seem to be completely missing the point (hint: chocolate releases endorphins in both some men and women).

    The point is of course that your argument for purpose in the world does not appear to be very logical.

    ETA: to illustrate the absurdity of trying to assess purpose in nature, consider the reasonableness of claiming that clearly some god created humans with noses and ears for the expressed purpose of holding eyeglasses on our faces…

  23. Corneel: Or perhaps you suck at explaining yourself

    Are you seriously suggesting that the morphology and behaviour of gazelles does not show specific adaptations for escaping large pursuit predators?

    BTW Are you comfy in your hole? Deep already isn’t it?

    They do not show adaptations. That is your evolutionary narrative. You imagine that gazelles evolved defenses. I say they had to have them apriori to exist. Defense is teleological. You cannot evolve a defense when you have no ability to grasp the meaning of survival. The first cell from an evolutionary narrative was dead in the water. No way to get to the next step. It has didly squat to work with.

    From a teleological POV, Life had to have the bells and whistles apriori otherwise it could not get off the ground.

    Morton’s demon is strong in this one. Again: Please read my reply to phoodoo who made a similar comment.

    Pot, meet kettle. Crazy isnt it how omicron saw an opportunity? Who would have thunk that omicron could even see, let alone see a rewarding opportunity. Oh, oh, but I know….those words of yours are just for communications’ sake. You dont really mean that omicron could know that there was a rewarding opportunity……right?

    Thanks for that. I have trouble understanding your position though: it appears to be a mixture between special creation and front-loading. Could you tell us whether you believe species/kinds to be immutable or do you allow for diversification within kinds?

    Front-loading. Evolution is dead. It was rolled out to create the biosphere then went dormant when the task was completed.

    Now all we see is maintenance programs at work, detecting defects, repairing as best can do.

  24. Steve was playing the same game wanting to play with words.

    Sorry to break it to you Alan, I believe there is a lot more playing with words on your side when it comes to evolutionary narratives. It is your side that is driving a counter-intuitive narrative to purpose for political reasons. You want to displace religion/theology as the dominant influence in society. But science doesn’t help you in this regard. That is why you have to co-opt teleological language- to kickstart the evolutionary marketing campaign. It won’t fly without teleology. So it has to be teleology but not teleology. Word games.

    Design will always win out over evolution because people cannot disown themselves.

  25. Fair Witness: You must be a follower of Perry Marshall and his Evolution 2.0.He believes that all of life’s variety was front-loaded into DNA from the start.

    I am not a follower of Perry Marshal but I do not disagree with his perspective. It is the most rational position to take when considering all the evidence in our own bodies.

  26. Alan Fox: But what has been your goal or purpose here?

    I want to take back the word teleology from people who want to use it to mean candles buring and water evaporating.

    Because any serious inquiry into the causes of intelligent life that uses the word teleology isn’t talking about a blind bag of chemicals forced to move energy from one state to another based on sheer random luck.

    I also want to take back the word emergence, from being a mystical euphemism for poof, to retuning to meaning simply, a system of whole, which is different than the each of its individual parts. I.e, a car emergences when one puts four tires, an engine, and a drive system and a steering system together it becomes a car, and not a tire. Note the lack of implied magic.

  27. phoodoo: I want to take back the word teleology from people who want to use it to mean candles buring and water evaporating.

    Because any serious inquiry into the causes of intelligent life that uses the word teleology isn’t talking about a blind bag of chemicals forced to move energy from one state to another based on sheer random luck.

    I also want to take back the word emergence, from being a mystical euphemism for poof, to retuning to meaning simply, a system of whole, which is different than the each of its individual parts.I.e, a car emergences when one puts four tires, an engine, and a drive system and a steering system together it becomes a car, and not a tire.Note the lack of implied magic.

    I’m with you all the way on that. 👍

  28. phoodoo: You think that Aristotle was the first person to consider that life isn’t chaos, but rather appears purposeful? You think there has been a person alive ever who hasn’t noticed that?

    Aristotle was the first philosopher in the Western tradition to realize that an intelligent designer is not required to explain why living things have goals and purposes.

    phoodoo: also want to take back the word emergence, from being a mystical euphemism for poof, to retuning to meaning simply, a system of whole, which is different than the each of its individual parts. I.e, a car emergences when one puts four tires, an engine, and a drive system and a steering system together it becomes a car, and not a tire. Note the lack of implied magic.

    The question of emergence vs reduction concerns how we think about causal powers. If the car has causal powers of its own that cannot be understood in terms of the additive effect of the causal powers of each of its components, then the car is emergent with regard to those components.

    This is why the Gestalt psychologists liked to say “the whole is different from the sum of its parts”: the whole involves a configuration or organization (hence Gestalt, “form”) that is distinct from a mere list of all the parts, taken individually without attention to the new causal powers based on their interactions.

    Emergence isn’t “magic”. It’s the rejection of the assumption that causal efficacy is an intrinsic property.

    If causal efficacy is an intrinsic property, then we can assign causal power a to entity x, causal power b to entity y, causal power c to z. Then the sum of x, y, and z — call this being q — has the causal power d, which the sum of a, b, and c.

    By contrast, if causal powers are not intrinsic properties but relational properties, then there’s no obstacle to realizing that new relations bring forth new causal powers. And that’s all that emergentism requires. No magic, just a different way of thinking about the metaphysics of causation.

    The reason why a car is not emergent with regard to its parts is because we design the parts to be relatively static and inelastic relative to the energies that are transmitted through them, so there’s very little causal spread across the parts. Such a system is simple, because there are very few possible interactions between the components.

    Whereas in a cell, there are both many different kinds of components — molecules of quite different masses, electrostatic properties — and many different possible relations between those components. A system with high complexity needs multiple constraints in order to reduce the degrees of freedom possible for the system to have. Constraints in turn need to be relatively buffered from entropy in order to continue to work, and life accomplishes that by having constraints that extract energy from the environment in order to do work — work that in turn regenerates constraints and keeps the system as a whole at far from equilibrium.

    The reason why cellular activities are emergent relative to their molecular constituents is because the complexity of the system results in causal spread across the system: the configurations of components brings forth new causal powers, since causal powers are relational, not intrinsic.

    If anything, the assumption that causal powers are wholly intrinsic to entities is a vestige of the mechanistic worldview that contemporary biology has long since left behind.

  29. Steve: They do not show adaptations. That is your evolutionary narrative. You imagine that gazelles evolved defenses.

    Bzzzt, wrong. The concept of adaptation predates Darwin’s account by a very long time. The idea can be traced back to Aristotle, who was already being discussed by KN and phoodoo here. The existence of adaptations was also readily accepted by creationists, most famously by William Paley of watchmaker fame.

    I actually used that term because I believed it to be neutral in our discussion. It is hi-la-re-ous that you are so reluctant to acknowledge the existence of adaptations because you perceive it to be tainted by evolutionary theory.

    Steve: Crazy isnt it how omicron saw an opportunity? Who would have thunk that omicron could even see, let alone see a rewarding opportunity. Oh, oh, but I know….those words of yours are just for communications’ sake. You dont really mean that omicron could know that there was a rewarding opportunity……right?

    Yep, exactly right. Now, will you be responding to the actual argument?

    Steve: Front-loading. Evolution is dead. It was rolled out to create the biosphere then went dormant when the task was completed.

    Now all we see is maintenance programs at work, detecting defects, repairing as best can do.

    So the current biodiversity is the result of evolution (which was front-loaded into a few created kinds), but it stopped when the program reached some predetermined end-goal. Did I understand this correctly?

    I am also intrigued by the “maintenance programs”. What exactly do you mean by that?

  30. Kantian Naturalist,

    Is a spark plug a car?

    Kantian Naturalist: Emergence isn’t “magic”. It’s the rejection of the assumption that causal efficacy is an intrinsic property.

    No it’s not. You can hijack the word for your own purposes and say it means anything, but that is not what it means outside of your own mind.

    Perhaps the word emergence emergences as something else when you use it.

    Kantian Naturalist: The reason why a car is not emergent with regard to its parts is because we design the parts to be relatively static and inelastic relative to the energies that are transmitted through them, so there’s very little causal spread across the parts. Such a system is simple, because there are very few possible interactions between the components.

    Whereas in a cell, there are both many different kinds of components — molecules of quite different masses, electrostatic properties — and many different possible relations between those components. A system with high complexity needs multiple constraints in order to reduce the degrees of freedom possible for the system to have. Constraints in turn need to be relatively buffered from entropy in order to continue to work, and life accomplishes that by having constraints that extract energy from the environment in order to do work — work that in turn regenerates constraints and keeps the system as a whole at far from equilibrium.

    Nowhere, nowhere, nowhere, is that the defintion of emergence, other than in your own mind.

    This is why Alan.

  31. phoodoo: You can hijack the word for your own purposes and say it means anything, but that is not what it means outside of your own mind.

    Hummm. Tasty, tasty snack.
    It’s very clear phoodoo, that the person offering up the most idiosyncratic, nonstandard, and personal definitions of terms here is you, phoodoo.
    Although Charlie has his moments. 😉

  32. DNA_Jock,

    Emergent properties are properties that manifest themselves as the result of various system components working together, not as a property of any individual component.

    To put that another way, it is a property that a complex system or collection of system parts has, but which individual parts do not possess.

    The term is used within systems theory, science, philosophy, and even creative mediums and it encapsulates the idiom of something being “greater than the sum of its parts”. Since emergent properties are viewable at more macro levels of analysis, only examining individual parts of the system will prevent one from seeing emergent properties. Examples of emergent properties include biochemical systems, the brain, and ant colonies.

    Let’s take a closer look at some examples of emergent properties and discuss how the property only manifests itself at the correct level of analysis.

    Examples Of Emergent Properties
    Ant Colonies

    One of the easiest examples of emergent properties to grasp is ant colonies. If one were to continually observe a single ant, the ant would seem to move around with little purpose and accomplish very little. However, when one observes the actions of the colony as a whole, it is clear how the many ants working together are able to accomplish an impressive variety of tasks. Many multiple ants working together can build dams and mounds and transfer large amounts of food from one area to another. The emergent property appears as the result of many ants being organized together.

    Here, I did you a favor and chose a source most favorable to your side, Science Trends.

    What exactly in this defintion doesn’t apply to spark plugs and cars? If you look at a spark plug and how it works, you can know it drives pistons, which in turn turn wheels, which are moved by a steering column? Its any different than seeing an individual ant?

    No magic involved. The only difference between using this term for a car and for biological systems, is when you use it for most biological systems, you are simply guessing at how it works. Actually you have no idea. In biology its used to replace the term “How the fuck should I know?”

  33. phoodoo: If you look at a spark plug and how it works, you can know it drives pistons

    Don’t you mean to say that you don’t know it drives pistons, and only by observing it in the context of the rest of the car does it’s function in the car become obvious?

    It’s not clear what you are even trying to argue with this car analogy. That cars aren’t emergent, or that they are emergent?

    phoodoo: No magic involved.

    We know and agree that emergence isn’t magic.

    phoodoo: The only difference between using this term for a car and for biological systems, is when you use it for most biological systems, you are simply guessing at how it works. Actually you have no idea. In biology its used to replace the term “How the fuck should I know?”

    Projection.

  34. Rumraket: We know and agree that emergence isn’t magic.

    Great, then let’s hope others (ahem) stop using the word to say consciousness “emerges” from far from thermodynamic equilibrium states while extracting energy and matter from the environment and converting that energy into work that is used to mitigate increases in entropy.

    Because not only can we not observe and understand this at the micro level, we can’t even at the macro one.

    But indeed we can figure out how spark plugs work.

  35. Bzzzt, wrong. The concept of adaptation predates Darwin’s account by a very long time. The idea can be traced back to Aristotle, who was already being discussed by KN and phoodoo here. The existence of adaptations was also readily accepted by creationists, most famously by William Paley of watchmaker fame.

    I actually used that term because I believed it to be neutral in our discussion. It is hi-la-re-ous that you are so reluctant to acknowledge the existence of adaptations because you perceive it to be tainted by evolutionary theory.

    Psst. What is happening here is you are purposefully conflating adaptations with variation. Creationists accept variation within kinds. In fact, variation within kinds is observable today. Speciation is not observed regardless of your (pl) objections. Evolution defined as cumulative inherited change in a population [adaptations] of organisms through time leading to the appearance of new forms is false.

    Talk about word games. Sheesh.

    So the current biodiversity is the result of evolution (which was front-loaded into a few created kinds), but it stopped when the program reached some predetermined end-goal. Did I understand this correctly?

    Correct-amundo. With design, you want all manner of living things, creepy-crawly things (natural earth tillers and fertilizing agents), plants and trees (food and housing for animals), birds and other flying things (pollinators), bacteria (digestive and composting agents), viruses (regulatory agents), etc, etc that creates an inter-connected whole.

    As we can see the biosphere is in fact complete. There are no new forms. So apparently no new forms are capable of being created. Evolution is not happening. But I repeat myself.

    I am also intrigued by the “maintenance programs”. What exactly do you mean by that?

    It should be obvious. Our bodies are able to scan their own DNA, detect errors and repair them to the best of its ability. Why does the body have this capability? To maintain what exists. In a perfect world, it would be enough to keep bodies going probably for hundreds of years. I suspect the Bible was not lying when it said Noah lived for 900 years. You (pl) are probably chuckling under your breath at the thought of it. Fine with me. No skin off my back. But I do know that if we treated our bodies correctly, we would not be impeding our body’s ability to maintain itself . We wouldn’t be eating barbeque, doritos, drinking (and snorting) Coke, and what other stuff (God only knows) what we put in our bodies that overwhelm our natural ability to maintain in good condition what was handed to us.

    As it relates to the pandemic and natural immunity, it is the same thing. Our bodies are fully capable of handling any and I mean any disease if we don’t get in our own way. However, because of a slew of bad individual AND collective decision making our natural abilities are compromised. Enter Man’s designed medicine – an…ahem… white knight saving us from disease. How ironic that peddlers of evolution implore us (to put it mildly) to kneel at the altar of designed medicine as the only way out of this pandemic.

    Black is the new White.

  36. Steve:
    I think you misunderstood my comment. You were arguing against purpose in vistas and chocolate. I was responding to your faulty logic in defense of their lack of purpose.

    You haven’t actually demonstrated that my logic is faulty or that there’s a meaningful, non-arbitrary way of determining “purpose”. That was my point, which you haven’t actually addressed.

    To be sure, it does not follow that because some people are near-sightedtherefore vistas have no purpose. Likewise, the fact that there are diabetics that should stay away from chocolate does not mean that chocolate has no purpose.

    Of course – that’s why I noted that as a parody. By the same token, the fact that there are people who can see and who subsequently enjoy vistas does not mean that people’s enjoyment is a vistas’ purpose or that vistas have any purpose. That’s the problem with your argument.

    Here I will make a defense of vistas and chocolate as having purpose.

    The design of the earth makes for eye-dropping scenery.Why should any person have a reaction to a vista, have any sense of beauty swimming in their brains? Does beautiful scenery impact our species survivability?Not in the least.Brute strength is all that is necessary. Get, eat, reproduce, repeat.

    Vistas speak to beauty which can be said to be synonymous with quality.The purpose of beautiful scenery is to provide a quality experience.Otherwise, humans would not have a faculty to recognise beauty. It can also be said that vistas create a sense of awe in humans that will encourage good stewardship of the land. A lota lota purpose in that.

    Appreciating scenery could simply be a side-effect of being able to perceive and analyze the relative merits of a given environment for food production, shade, water retention and replenishment, overall resource content, etc. Your inducing “purpose” simply doesn’t follow from any actual characteristic of scenery appreciation.

    Chocolate is obviously purposeful like any foodstuff.Chocolate was invented as a drink and mixed with chili, vanilla, and other spices.So since its inception it seems to have been created as a feel good consumable. How is there not purpose in that?

    People who manufacture products out of chocolate certainly are making their chocolate products with that purpose in mind. But there is no indication that cacao, in and of itself in nature (from which chocolate is derived), is there for the purpose of being converted into chocolate for human consumption.

    Anything that is created will exhibit purpose, whether intrinsic or extrinsic.

    I’ll certainly buy the argument that anything created by people exhibits purpose. Outside of our activities, I don’t see any evidence or reason to assume purpose of any kind.

  37. phoodoo: Nowhere, nowhere, nowhere, is that the defintion of emergence, other than in your own mind.

    I described the concept of emergence based on the discussion in Denis Walsh’s Organism, Agency, and Evolution (2015) and Terrence Deacon’s Incomplete Nature (2007). Deacon connects the concept of emergence to situates in which ordinary mereology fails, which happens when causality is not clearly localized to discrete parts of a system due to complexity. Walsh for his part frames his response to Jaegwon Kim’s well-known criticism of emergence in his “The Myth of Non-Reductive Naturalism (1989).

    Deacon and Walsh both draw upon Lloyd Morgan’s Emergent Evolution (1922) and Roy Wood Sellars’s Evolutionary Naturalism (1922), both of which are early texts in the concept of emegentism. Walsh and Deacon, along with many others, use ideas from second-order cybernetics and general systems theory to refute criticisms of emergentism.

    In other words, my use of emergence is perfectly consistent with that of the philosophers and scientists who use that term. The fact that you are entirely ignorant of this history does not mean that I do not know what I’m talking about.

    Rumraket: Don’t you mean to say that you don’t know it drives pistons, and only by observing it in the context of the rest of the car does it’s function in the car become obvious?

    It’s not clear what you are even trying to argue with this car analogy. That cars aren’t emergent, or that they are emergent?

    Phoodoo’s point is that emergence is only a function of ignorance. On his view, cars are not emergent because we know how the parts interact to make the whole car function. As he sees it, we call a system “emergent” when we don’t know how the parts contribute to the whole, and we withhold that term when we do know how the parts contribute to the whole (as with cars).

    Needless to say, I regard phoodoo’s point as itself based on complete ignorance of the relevant philosophical and scientific issues.

  38. phoodoo: Great, then let’s hope others (ahem) stop using the word to say consciousness “emerges” from far from thermodynamic equilibrium states while extracting energy and matter from the environment and converting that energy into work that is used to mitigate increases in entropy.

    Hey I would actually agree with you on that as that’s rather vacuous.

    I will just note that I think we should also equally stop saying dumb shit like this:

    The only difference between using this term for a car and for biological systems, is when you use it for most biological systems, you are simply guessing at how it works. Actually you have no idea. In biology its used to replace the term “How the fuck should I know?”

  39. Steve: What is happening here is you are purposefully conflating adaptations with variation.

    Why would I do such a silly thing? I define adaptation here as a trait that increases the ability of an individual to survive or reproduce compared to individuals that are lacking this trait. Most adaptations are fixed within populations (e.g. all ducks have webbed feet). Hence, adaptations can occur without variation being present for that particular trait.

    Steve: Creationists accept variation within kinds.

    Yes they do. And most of them also accept that adaptations exist. Except you Mr. Squirmy McSquirm.

    Steve: Me: So the current biodiversity is the result of evolution (which was front-loaded into a few created kinds), but it stopped when the program reached some predetermined end-goal. Did I understand this correctly?

    Steve: Correct-amundo.

    Excellent. Then I suppose the first question is: Why did the Designer not create the complete biosphere in one go? Am I correct in guessing that the story of Noah’s ark has something to do with this curious bottleneck?

    Steve: Me: I am also intrigued by the “maintenance programs”. What exactly do you mean by that?

    Steve: It should be obvious. Our bodies are able to scan their own DNA, detect errors and repair them to the best of its ability. Why does the body have this capability?

    But despite DNA polymerase proofreading and various repair mechanisms, mutations happen nonetheless. What is going to stop them from accumulating?

  40. Robin: I’ll certainly buy the argument that anything created by people exhibits purpose. Outside of our activities, I don’t see any evidence or reason to assume purpose of any kind.

    That’s a bit anthropocentric, if you ask me.

  41. Rumraket: Hey I would actually agree with you on that as that’s rather vacuous.

    Since phoodoo is paraphrasing from me, what’s vacuous about my view? I do suspect there are lots of problems with the Mossio and Moreno view that I’ve been presenting here, and I’d be curious to know what you think they are.

    BTW, phoodoo got one thing wrong: I’m not talking about consciousness, I’m talking about life in the biological sense. I don’t think that bacteria are conscious.

  42. Kantian Naturalist: I’m not talking about consciousness, I’m talking about life in the biological sense. I don’t think that bacteria are conscious.

    Watch out! Someone will redefine consciousness so that bacteria are conscious, or even so that grains of sand or hydrogen atoms are conscious. Those fall under what may be called The Useless Definition of Consciousness.

  43. Joe Felsenstein: Watch out! Someone will redefine consciousness so that bacteria are conscious, or even so that grains of sand or hydrogen atoms are conscious. Those fall under what may be called The Useless Definition of Consciousness.

    Ha! I know you were joking but alas, panpsychism is making a huge comeback thanks mostly to recent work by Philip Goff.

  44. Steve: …Our bodies are able to scan their own DNA, detect errors and repair them to the best of its ability…

    Corneel makes a good point about how errors accumulate despite the error correction. Even PC operating systems have better error correction than our DNA. What kind of buffoon designed us? Is he not even as smart as Bill Gates?

  45. Kantian Naturalist: Since phoodoo is paraphrasing from me, what’s vacuous about my view? I do suspect there are lots of problems with the Mossio and Moreno view that I’ve been presenting here, and I’d be curious to know what you think they are.

    As an explanation for how or why consciousness emerges, I don’t think it succeeds because I just don’t see how that description should somehow entail the emergence of consciousness.

    If however phoodoo is misrepresenting you, and you’re instead “merely” talking about how life arises from that list of physical phenomena, I’m there with you. I know what each of those phenomena and concepts refer to, and I think they’re all essential attributes of life as we know it.

  46. Kantian Naturalist: BTW, phoodoo got one thing wrong: I’m not talking about consciousness, I’m talking about life in the biological sense.

    Well, why not consciousness? I mean, doesn’t your explanation refer to intelligence ? To memory? To decisions? To actions? Aren’t all of these just properties of the far from equillibrium?

    The other problem of creating the word emergent to cover things we don’t understand is that there are other far from equillibrium systems, so why aren’t they also intelligent. Is the weather intelligent? Does it make choices? Is it alive? The problem with your use of the word emergent is that it doesn’t actually explain anything. If something “emerges” in a way in which we have no idea how, what have we even said? At least in terms of ant colonies, to the extent we do understand them, it explains the eventual outcome. Each ant contributes one small part ot a complete system, and there is no mystery needed.

    Other than how in the hell did they learn that. But just add that to everything else we don’t know about life.

  47. I wonder where it is in a cat’s DNA that teaches it to stretch it paws out, and arch its back to loosen up its muscles and make it more agile? Since all cats do it, I guess it could just be an emergent property of far from equillibrium states.

  48. phoodoo: I wonder where it is in a cat’s DNA that teaches it to stretch it paws out, and arch its back to loosen up its muscles and make it more agile? Since all cats do it, I guess it could just be an emergent property of far from equillibrium states.

    After some meticulous research I found the genomic region that is responsible for this typical cat behaviour. Interestingly, it turns out to be a repeat region:

    CATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT

  49. Kantian Naturalist:
    CharlieM,

    I was thinking primarily of Talbott’s criticism of cybernetics:

    Talbott: “If you’re thinking, “Well, a cruise missile is surely goal-directed, and corrects its course using feedback”, then I am afraid you are taking the engineer’s point of view, not the machine’s. Yes, the human-imposed design is purposive, and will be reflected in the machine’s performance, so long as it is working well. But variance in the functioning of the parts, which include the feedback mechanisms, will have a very different effect compared to the dramatic variances a cell and organism can tolerate for example in its gene expression networks. That’s because the missile’s apparent intentions are not immanent in the machine itself.”

    This is pretty much the same criticism that Hans Jonas makes about why cybernetics cannot naturalize teleology. (See A Critique of Cybernetics.) And like Talbott, Jonas thinks that what sets apart genuine teleology from any artificial simulation is that the former has interiority or inwardness.

    Yes, the views of Jonas and Talbott do seem to overlap here. If Talbott did read his work he would have found some common ground to be sure.

    I have read the Jonas article you linked to and I found it interesting.

    He wrote:

    The modern servo-mechanism is described as perceptive, responsive, adaptive, purposive, retentive, learning, decision-making, intelligent and sometimes even emotional (but this last only if something goes wrong!), and correspondingly, men and human societies are being conceived of and explained as feedback mechanisms, communication systems, and computing machines. The use of an intentionally ambiguous and metaphorical terminology facilitates this transfer back and forth between the artifact and its maker…

    Later materialists repudiated the Cartesian dualism in name only. . That mind is an epiphenomenon of material processes in the brain, as they held, remained a summary assertion not leading to such actual correlations and transformations as would invade the field of mind itself with the symbolism of physical science.

    He goes on to criticize the claim of some cyberneticians that the dualism has been overcome. Out of three topics which can be scrutinized, teleology, information, and mind, Jonas continues:

    I have chosen for analysis here the first of them : the cybernetical concept of purpose and teleology. This is basic to the whole scheme, and I grant at the outset that if cybernetics makes good its claim with regard to these terms-that they can be evolved from mechanical premises alone-it has carried its main point and resolved an age-old dualism. I propose to show that the resolution claimed is spurious and mainly verbal.

    According to Jonas, the “cybernetic model reduces animal nature to the two terms of sentience and motility”, while simply ignoring the fact that they should be dealing with a triad, sentience, motility, and emotion.

    Kantian Naturalist: I know from email exchanges with Talbott that his most fundamental inspiration is Coleridge and the Romantic Naturphilosophie that he brought to English arts and letters at the dawn of the 19th century. There’s a good deal of Goethe in that tradition, but of course much else besides.

    I’m sure the fundamental source of Talbott’s inspiration will change depending on the topic he is attending to.

    I would say that what does inspire him is a type of science that has been given many names but which lays emphasis on a qualitative, participatory approach.

Leave a Reply