…the noyau, an animal society held together by mutual animosity rather than co-operation
Robert Ardrey, The Territorial Imperative.
[to work around page bug]
…the noyau, an animal society held together by mutual animosity rather than co-operation
Robert Ardrey, The Territorial Imperative.
[to work around page bug]
You must be logged in to post a comment.
Like the bits about slavery?
Oh, I thought you were going to take issue, him being a slave owner. You’ve piqued my curiosity now.
Mung,
Did he do that? His black family were treated reasonably well by the standard of the time.
ETA The Stanford Encyclopedia of Philosophy I linked to above has a section on race that’s worth a read.
Mostly I’m curious about his disagreements with Madison regarding democracy, the Constitution, stuff like that.
Here is a 7-minute video that explains my journey from nearly leaving the Christian faith in 2001 and then eventually returning to it. I explain this in the context of the 2018 holiday season. It also (indirectly) explains how I got involved in ID and Creation Science.
Before the thread disappears, lol.
https://discourse.peacefulscience.org/t/mung-and-swamidas-again/3434
Mung,
It disappeared behind ‘login required.’ Do send highlights. ; )
I skimmed it. Makes me wonder whatever happened to “turn the other cheek”. Especially given the site’s purpose. But perhaps you mean it as some kind of meta-irony (if that is a thing) for that site?
Jordan Peterson on evidence engineers biologically tend to be male and nurses female. This could be extend to so many other questions and the mythical wage gap.
https://nationalpost.com/opinion/jordan-peterson-the-gender-scandal-in-scandinavia-and-canada
Peterson pointed out elsewhere Engineers in the scandinavian countries are 95% male, and nurses 95% female, or something like that. I have to ask, why should feminist see this as a problem??? I mean 90% of prisoners and criminals are male, do feminist want equality there? Hey, lets impose a gender quota on the prison population. That means releasing 80% of the prisoners so we have half men and half women. Absurdity!
For one thing I posted a screenshot, which somehow got turned into a picture of something completely different from what I posted. Deja Vu.
ETA: They have a “Back Porch” category which requires you to be logged in to view. So if a thread gets moved to “Back Porch” only people who are logged in will be able to see it.
A 5-minute explanation for one of the reasons I don’t think the fossil record represents millions of years:
It’s not that I hate ignorance, but that I hate ignorance posing as knowledge or understanding.
Jordan Peterson vs Brett Weinstein.
Peterson explains that Marxism fails to account for Pareto principle:
Jesus said: “those who have, more will be given, those who have not, what little they have will be taken away.” The Pareto Principle.
stcordova,
That would be interesting if Peterson had a correct understanding of Marx.
KantianNaturalist,
Whatever Marx said or meant, what counts as far as I’m concerned personally is how his proponents like Mao and Stalin and countries like Venezuela and Cuba North Korea or Pol Pot in Cambodia have interpreted and implemented Marxism. The outcome was not good.
There are probably systemic reasons why strongly centralized state control of everything eventually results in all sorts of brutality. Part of the reason is if the government leaders have no morals and have no motivation to seek the welfare of the people rather than themselves, it’s natural they will treat the populace badly and they eventually ignore all the written principles and promises they made during their rise to power.
It’s extremely presumptuous to think that socialist leaders have motivation to be ethical once they are in power. It’s an unfortunate side of human nature that has a long history of playing out when power is given to someone that may have been reasonably idealistic at the start of their careers but then slowly become corrupt over time.
I think I’ve been misunderstood throughout the thread, lol. So no worries.
I could care less about the “is it really a motor” or “is it really an engine” debate. We may as well debate whether gravity is a propellant.
The point I was trying to make was how one could misread what someone else wrote and then try to make a big deal over it. If I say “the RX-7 motor” am I claiming that the RX-7 IS A MOTOR? Obviously not. But the idea floated in this thread is that Brian Miller was saying the flagellum IS A MOTOR. It’s silly. It diminishes the site.
What do you think Brian was referring to when he wrote “the bacterial rotary motor”? If he meant to say that the flagellum is a motor why did he fail to mention the flagellum?
The opening post offers us a pretense. A fiction. That Brian Miller thinks the flagellum is a motor. Not that there is a motor at the base of the flagellum, not that the flagellum has a motor which drives its rotation, but that the flagellum IS A MOTOR. It’s dishonest. It’s unbecoming. This entire thread is a perfect example of the things that are wrong with this site.
Just take a look at the exchange between Joshua and Dale. What a disgrace.
https://discourse.peacefulscience.org/t/the-flagella-is-not-a-motor/3801/230
LoL. Post hidden. 🙂
Maybe it should be renamed? How about Disgraceful Science?
New thread at Peaceful Science, aka Peaceful Creationism.
Who Josh Trusts
It’s been relegated to the Back Porch. So members only.
His list of who he trusts…
“Bacteria swim by means of flagella, which are locomotive chemiosmotic nanomachines that are widely distributed among this kingdom. This structure utilizes the energy from the electrochemical gradient to generate torque and propel the cell through its environment”
https://jb.asm.org/content/189/22/7998
“The bacterial flagellar motor is a complex biological rotary molecular motor, which is situated in the cell envelopes of bacteria. Whereas most biological motors use adenosine triphosphate as their energy source, the rotation of the flagellar motor is driven by a flow of charged ions across the bacterial plasma membrane. The motor powers the rotation of helical flagellar filaments at speeds of up to several hundred hertz. These rotating filaments act like propellers, pushing the cells through their environment. The motors are regulated by one of the best‐characterised biological signalling pathways, the chemotaxis pathway. This pathway changes the swimming pattern of the bacteria in response to changes in the concentration of external chemicals so that they move into environments, which are optimal for their growth. Other pathways can regulate the flagellar motor and the motor itself can respond to changing conditions by adapting parts of its structure.”
http://www.els.net/WileyCDA/ElsArticle/refId-a0000744.html
The official belief is that “…the bacterial flagellum motors use adenosine triphosphate as their energy source, the rotation of the flagellar motor is driven by a flow of charged ions across the bacterial plasma membrane.”
However:
“The flagellum is highly energy efficient and uses very little energy.[23][unreliable source?] The exact mechanism for torque generation is still poorly understood.[24] Because the flagellar motor has no on-off switch, the protein epsE is used as a mechanical clutch to disengage the motor from the rotor, thus stopping the flagellum and allowing the bacterium to remain in one place.[25]”
https://en.m.wikipedia.org/wiki/Flagellum
Since the bacterial flagellum propelling is a highly energy efficient process and bacteria use photosynthesis, and we now know that photosynthesis is quantum because it is almost 100% efficient, then the question still remains whether bacterium flagellum could possibly use some known or unknown quantum processes for the mechanism of torque generation…
Until someone can experimentally prove it one way or another, it remains a matter of speculations…well… officially at least…lol
I can’t wait to review Dr. Swamidass’ upcoming book…I have more than a few surprises for him… 😉
Where does the “100% efficiency of photosynthesis” come from? For sugar cane, which is regarded as close to the most efficient photosynthesiser, about eight per cent of light energy is preserved as chemical energy by photosynthesis.
But how will he find out J-Mac? Do you have a blog? Should someone let him know that there’s a mouse scratching at his door? Why should he take you seriously?
As requested, J-Mac, here is an enzyme that I designed and built:
See if you can spot the extra bit that I added, J-Mac. This should be easy if you know anything about proteins.
MQIELSTCFFLCLLRFCFSATRRYYLGAVELSWDYMQSDLGELPVDARFPPRVPKSFPFNTSVVYKKTLFVEFTDHLFNIAKPRPPWMGLLGPTIQAEVYDTVVITLKNMASHPVSLHAVGVSYWKASEGAEYDDQTSQREKEDDKVFPGGSHTYVWQVLKENGPMASDPLCLTYSYLSHVDLVKDLNSGLIGALLVCREGSLAKEKTQTLHKFILLFAVFDEGKSWHSETKNSLMQDRDAASARAWPKMHTVNGYVNRSLPGLIGCHRKSVYWHVIGMGTTPEVHSIFLEGHTFLVRNHRQASLEISPITFLTAQTLLMDLGQFLLFCHISSHQHDGMEAYVKVDSCPEEPQLRMKNNEEAEDYDDDLTDSEMDVVRFDDDNSPSFIQIRSVAKKQGKTWVHYIAAEEEDWDYAPLVLAPDDRSYKSQYLNNGPQRIGRKYKKVRFMAYTDETFKTREAIQHESGILGPLLYGEVGDTLLIIFKNQASRPYNIYPHGITDVRPLYSRRLPKGVKHLKDFPILPGEIFKYKWTVTVEDGPTKSDPRCLTRYYSSFVNMERDLASGLIGPLLICYKESVDQRGNQIMSDKRNVILFSVFDENRSWYLTENIQRFLPNPAGVQLEDPEFQASNIMHSINGYVFDSLQLSVCLHEVAYWYILSIGAQTDFLSVFFSGYTFKHKMVYEDTLTLFPFSGETVFMSMENPGLWILGCHNSDFRNRGMTALLKVSSCDKNTGDYYEDSYEDISAYLLSKNNAIEPRRRRREITRTTLQSDQEEIDYDDTISVEMKKEDFDIYDEDENQSPRSFQKKTRHYFIAAVERLWDYGMSSSPHVLRNRAQSGSVPQFKKVVFQEFTDGSFTQPLYRGELNEHLGLLGPYIRAEVEDNIMVTFRNQASRPYSFYSSLISYEEDQRQGAEPRKNFVKPNETKTYFWKVQHHMAPTKDEFDCKAWAYFSDVDLEKDVHSGLIGPLLVCHTNTLNPAHGRQVTVQEFALFFTIFDETKSWYFTENMERNCRAPCNIQMEDPTFKENYRFHAINGYIMDTLPGLVMAQDQRIRWYLLSMGSNENIHSIHFSGHVFTVRKKEEYKMALYNLYPGVFETVEMLPSKAGIWRVECLIGEHLHAGMSTLFLVYSNKCQTPLGMASGHIRDFQITASGQYGQWAPKLARLHYSGSINAWSTKEPFSWIKVDLLAPMIIHGIKTQGARQKFSSLYISQFIIMYSLDGKKWQTYRGNSTGTLMVFFGNVDSSGIKHNIFNPPIIARYIRLHPTHYSIRSTLRMELMGCDLNSCSMPLGMESKAISDAQITASSYFTNMFATWSPSKARLHLQGRSNAWRPQVNNPKEWLQVDFQKTMKVTGVTTQGVKSLLTSMYVKEFLISSSQDGHQWTLFFQNGKVKVFQGNQDSFTPVVNSLDPPLLTRYLRIHPQSWVHQIALR
Others can PM me if they notice the other interesting thing about this sequence, which introduces oodles of FIASCO…
atgcagatcgagctgagcacctgcttcttcctgtgcctgctgcgcttctgcttcagcgccacccgccgctactacctgggcgccgtggagctgagctgggactacatgcagagcgacctgggcgagctgcccgtggacgcccgcttccccccccgcgtgcccaagagcttccccttcaacaccagcgtggtgtacaagaagaccctgttcgtggagttcaccgaccacctgttcaacatcgccaagccccgccccccctggatgggcctgctgggccccaccatccaggccgaggtgtacgacaccgtggtgatcaccctgaagaacatggccagccaccccgtgagcctgcacgccgtgggcgtgagctactggaaggccagcgagggcgccgagtacgacgaccagaccagccagcgcgagaaggaggacgacaaggtgttccccggcggcagccacacctacgtgtggcaggtgctgaaggagaacggccccatggccagcgaccccctgtgcctgacctacagctacctgagccacgtggacctggtgaaggacctgaacagcggcctgatcggcgccctgctggtgtgccgcgagggcagcctggccaaggagaagacccagaccctgcacaagttcatcctgctgttcgccgtgttcgacgagggcaagagctggcacagcgagaccaagaacagcctgatgcaggaccgcgacgccgccagcgcccgcgcctggcccaagatgcacaccgtgaacggctacgtgaaccgcagcctgcccggcctgatcggctgccaccgcaagagcgtgtactggcacgtgatcggcatgggcaccacccccgaggtgcacagcatcttcctggagggccacaccttcctggtgcgcaaccaccgccaggccagcctggagatcagccccatcaccttcctgaccgcccagaccctgctgatggacctgggccagttcctgctgttctgccacatcagcagccaccagcacgacggcatggaggcctacgtgaaggtggacagctgccccgaggagccccagctgcgcatgaagaacaacgaggaggccgaggactacgacgacgacctgaccgacagcgagatggacgtggtgcgcttcgacgacgacaacagccccagcttcatccagatccgcagcgtggccaagaagcaggggaagacctgggtgcactacatcgccgccgaggaggaggactgggactacgcccccctggtgctggcccccgacgaccgcagctacaagagccagtacctgaacaacggcccccagcgcatcggccgcaagtacaagaaggtgcgcttcatggcctacaccgacgagaccttcaagacccgcgaggccatccagcacgagagcggcatcctgggccccctgctgtacggcgaggtgggcgacaccctgctgatcatcttcaagaaccaggccagccgcccctacaacatctacccccacggcatcaccgacgtgcgccccctgtacagccgccgcctgcccaagggcgtgaagcacctgaaggacttccccatcctgcccggcgagatcttcaagtacaagtggaccgtgaccgtggaggacggccccaccaagagcgacccccgctgcctgacccgctactacagcagcttcgtgaacatggagcgcgacctggccagcggcctgatcggccccctgctgatctgctacaaggagagcgtggaccagcgcggcaaccagatcatgagcgacaagcgcaacgtgatcctgttcagcgtgttcgacgagaaccgcagctggtacctgaccgagaacatccagcgcttcctgcccaaccccgccggcgtgcagctggaggaccccgagttccaggccagcaacatcatgcacagcatcaacggctacgtgttcgacagcctgcagctgagcgtgtgcctgcacgaggtggcctactggtacatcctgagcatcggcgcccagaccgacttcctgagcgtgttcttcagcggctacaccttcaagcacaagatggtgtacgaggacaccctgaccctgttccccttcagcggcgagaccgtgttcatgagcatggagaaccccggcctgtggatcctgggctgccacaacagcgacttccgcaaccgcggcatgaccgccctgctgaaggtgagcagctgcgacaagaacaccggcgactactacgaggacagctacgaggacatcagcgcctacctgctgagcaagaacaacgccatcgagccccgcaggcgcaggcgcgagatcacccgcaccaccctgcagagcgaccaggaggagatcgactacgacgacaccatcagcgtggagatgaagaaggaggacttcgacatctacgacgaggacgagaaccagagcccccgcagcttccagaagaagacccgccactacttcatcgccgccgtggagcgcctgtgggactacggcatgagcagcagcccccacgtgctgcgcaaccgcgcccagagcggcagcgtgccccagttcaagaaggtggtgttccaggagttcaccgacggcagcttcacccagcccctgtaccgcggcgagctgaacgagcacctgggcctgctgggcccctacatccgcgccgaggtggaggacaacatcatggtgaccttccgcaaccaggccagccgcccctacagcttctacagcagcctgatcagctacgaggaggaccagcgccagggcgccgagccccgcaagaacttcgtgaagcccaacgagaccaagacctacttctggaaggtgcagcaccacatggcccccaccaaggacgagttcgactgcaaggcctgggcctacttcagcgacgtggacctggagaaggacgtgcacagcggcctgatcggccccctgctggtgtgccacaccaacaccctgaaccccgcccacggccgccaggtgaccgtgcaggagttcgccctgttcttcaccatcttcgacgagaccaagagctggtacttcaccgagaacatggagcgcaactgccgcgccccctgcaacatccagatggaggaccccaccttcaaggagaactaccgcttccacgccatcaacggctacatcatggacaccctgcccggcctggtgatggcccaggaccagcgcatccgctggtacctgctgagcatgggcagcaacgagaacatccacagcatccacttcagcggccacgtgttcaccgtgcgcaagaaggaggagtacaagatggccctgtacaacctgtaccccggcgtgttcgagaccgtggagatgctgcccagcaaggccggcatctggcgcgtggagtgcctgatcggcgagcacctgcacgccggcatgagcaccctgttcctggtgtacagcaacaagtgccagacccccctgggcatggccagcggccacatccgcgacttccagatcaccgccagcggccagtacggccagtgggcccccaagctggcccgcctgcactacagcggcagcatcaacgcctggagcaccaaggagcccttcagctggatcaaggtggacctgctggcccccatgatcatccacggcatcaagacccagggcgcccgccagaagttcagcagcctgtacatcagccagttcatcatcatgtacagcctggacggcaagaagtggcagacctaccgcggcaacagcaccggcaccctgatggtgttcttcggcaacgtggacagcagcggcatcaagcacaacatcttcaacccccccatcatcgcccgctacatccgcctgcaccccacccactacagcatccgcagcaccctgcgcatggagctgatgggctgcgacctgaacagctgcagcatgcccctgggcatggagagcaaggccatcagcgacgcccagatcaccgccagcagctacttcaccaacatgttcgccacctggagccccagcaaggcccgcctgcacctgcagggccgcagcaacgcctggcgcccccaggtgaacaaccccaaggagtggctgcaggtggacttccagaagaccatgaaggtgaccggcgtgaccacccagggcgtgaagagcctgctgaccagcatgtacgtgaaggagttcctgatcagcagcagccaggacggccaccagtggaccctgttcttccagaacggcaaggtgaaggtgttccagggcaaccaggacagcttcacccccgtggtgaacagcctggacccccccctgctgacccgctacctgcgcatccacccccagagctgggtgcaccagatcgccctgcgcatggaggtgctgggctgcgaggcccaggacctgtactag
E2make research easier
9-minute Episode #3 of Salvador Cordova’s Biochemistry video series at Creation Evolution University:
ERRATA: I have to fix the spelling of Quaternary at the end
DNA_Jock,
I wanted to make “WALTO” just using the letters in your first string, but I couldn’t find an “O”. I thought that was interesting.
Prolly, not what you were looking for though. 🙁
Funny you should mention that, but I did use the “reverse translation” software I wrote to create a DNA sequence that coded for a rather offensive (but hidden) message on our company’s T-shirts one year.
Sadly the single letter aa alphabet lacks B, J, U, X, Z, and as you noted O, so I was limited in which individuals I could mention in the message. I really wanted to give a hidden shout-out to by friend Doug…
For J-Mac:
https://www.ncbi.nlm.nih.gov/protein/ABV90867.1?report=genbank&log$=protalign&blast_rank=1&RID=54S3DMHV014
Feuding would be less likely, imo, if people were not personally attacked or misrepresented or singled out for special treatment.
I don’t like being lied about. No one does. I don’t like it when people make things personal. I don’t like it when someone does the very things they find objectionable in others. I don’t like it when someone refuses to admit they were in the wrong. I have a long list. 🙂
Salvador Cordova on the Jackson Wheat show (80-minute video):
When one finds silly comments like one this coming from people in the Evangelical Covenant Church, it helps put in perspective the crazy situation Swamidass is facing & why his thinking often appears so confused.
Ah yes, no population, no mutation, no ‘struggle for life’; yet she still calls that ‘evolution.’ Maybe this is why Swamidass sided with atheist Joe Brewer on social media over against me. He simply puts no limit on evolutionary thinking! Yawn.
Thanks Sal!
How does gay marriage have anything to do with evolutionary theory?
Homosexuality could…I have tried to engage people sympathetic the evolutionary theory on the homosexuality theme in one of my OPs with vering success…
If evolution can’t explain homosexuality as a genetic predisposition, are we forced to conclude that God designed it?
Doesn’t that imply God endorses it and wants it to exist, or does he just want some people to endure the torture of having to deny a basic nature he programmed into them?
Can evolution explain homosexuality?!
First of all, you would have changed the main paradigm of evolutionary theory, the survival of the fittest and the omnipotence of natural selection…
Are you ready to do that?
Can the tendency toward aggression be explained by evolution?
Didn’t God tell Cain to work on it or he was going to act on that tendency?
Remember what happened?
Darwinist Democratic Governor of Virginia who campaigned on the evils of racism may have gotten caught. Yearbook shows him with some guy in a Ku Klux Klan (white supremacist) outfit.
https://www.usatoday.com/story/news/politics/2019/02/02/virginia-governor-ralph-northam-racist-yearbook-photo-resignation-calls/2753016002/
In other news, I got me a new bumper sticker:
https://www.livetradingnews.com/wp-content/uploads/2018/03/trump-build-that-wall-701×393.jpg
In other news, I got me a new bumper sticker:
https://www.livetradingnews.com/wp-content/uploads/2018/03/trump-build-that-wall-701×393.jpg
The Mexican Wall has been built before…
Sal,
There are racists among both Darwinists and the religious…
Some churches played a major role in slavery and slave trade…
https://en.m.wikipedia.org/wiki/Catholic_Church_and_slavery
Muslims were also converted with the sword….
I don’t know. Why?
Neither of those are paradigms of evolutionary theory. That omnipotence thing is but religious projection. No scientists thinks that natural selection is omnipotent.
Yes. Why?
Yeah. God’s “potence” wasn’t enough to make humans less aggressive than if they had evolved under naturally challenging circumstances, with competition for resources. So, not omnipotent after all.
You’ve found a racist democrat? I suppose they’re so rare it’s news worthy when that happens. Meanwhile:
>You’ve found a racist democrat?
Identity politics is RACIST. Disgusting.
>You’ve found a racist democrat?
like Jesse Jackson who said when he turned around thinking he might be mugged and was relieved to see a white guy? lol
“There is nothing more painful to me at this stage in my life than to walk down the street and hear footsteps… then turn around and see somebody white and feel relieved.”
Another person tired of Swamidass’ manipulative, dishonest & highly edited version of ‘peacemaking!’
Few good points … but if evolution can’t explain homosexuality, should we look to DI to do that?
One close friend told me that: “… homosexuality is like a predisposition to sports… You either decide to become a sportsman or you say, this sport is tempting, but it is not for me…”
That’s STRONG accusation! Darwinists often use it when they have arguments against ID…
It could be against TSZ rules is keiths were a moderator…;-P
To be fair, we do not know whether that is Hurd’s reason for quitting.
Why is it restricted accesss then, if Swamidass has nothing to hide?
His last available post:
“Gary_Hurd
Anthropologist Champion of Evolution
Since Charles Darwin was totally clueless about the mechanics of heredity, no genetic discovery will do much to his theory of “decent with modification acted on by natural selection.” Barring special creation, descent is what we have left. And descent is all that fits the data. Darwin and “Darwinism” could care less about how the “modification part happened.” And I already showed that “natural selection” was quite flexible.
And, “positive selection dominated change” coupled with recombination is exactly what cleared away the creationist nonsense of John Sanford, and “genetic entropy.”
After that he may have said something the PS militia didn’t like…
I can still see it. But I guess it has been moved to the Back Porch where only signed in members can access it.
Why not hide all his OPs for peace sake rather than just the bad ones?
Neil Rickert:
I wrote:
Fine. Then, instead: Another person tired of Swamidass’ manipulative, dishonest & highly edited version of ‘peacemaking’?
“I have better ways to waste time,” speaks volumes.