Common Design vs. Common Descent

I promised John Harshman for several months that I would start a discussion about common design vs. common descent, and I’d like to keep my word to him as best as possible.

Strictly the speaking common design and common descent aren’t mutually exclusive, but if one invokes the possibility of recent special creation of all life, the two being mutually exclusive would be inevitable.

If one believes in a young fossil record (YFR) and thus likely believes life is young and therefore recently created, then one is a Young Life Creationist (YLC). YEC (young earth creationists) are automatically YLCs but there are a few YLCs who believe the Earth is old. So evidence in favor of YFR is evidence in favor of common design over common descent.

One can assume for the sake of argument the mainstream geological timelines of billions of years on planet Earth. If that is the case, special creation would have to happen likely in a progressive manner. I believe Stephen Meyer and many of the original ID proponents like Walter Bradley were progressive creationists.

Since I think there is promising evidence for YFR, I don’t think too much about common design vs. common descent. If the Earth is old, but the fossil record is young, as far as I’m concerned the nested hierarchical patterns of similarity are due to common design.

That said, for the sake of this discussion I will assume the fossil record is old. But even under that assumption, I don’t see how phylogenetics solves the problem of orphan features found distributed in the nested hierarchical patterns of similarity. I should point out, there is an important distinction between taxonomic nested hierarchies and phylogenetic nested hierarchies. The nested hierarchies I refer to are taxonomic, not phylogenetic. Phylogeneticsits insist the phylogenetic trees are good explanations for the taxonomic “trees”, but it doesn’t look that way to me at all. I find it revolting to think giraffes, apes, birds and turtles are under the Sarcopterygii clade (which looks more like a coelacanth).

Phylogeny is a nice superficial explanation for the pattern of taxonomic nested hierarchy in sets of proteins, DNA, whatever so long as a feature is actually shared among the creatures. That all breaks down however when we have orphan features that are not shared by sets of creatures.

The orphan features most evident to me are those associated with Eukaryotes. Phylogeny doesn’t do a good job of accounting for those. In fact, to assume common ancestry in that case, “poof” or some unknown mechanism is indicated. If the mechanism is unknown, then why claim universal common ancestry is a fact? Wouldn’t “we don’t know for sure, but we believe” be a more accurate statement of the state of affairs rather than saying “universal common ancestry is fact.”

So whenever orphan features sort of poof into existence, that suggests to me the patterns of nested hierarchy are explained better by common design. In fact there are lots of orphan features that define major groups of creatures. Off the top of my head, eukaryotes are divided into unicellular and multicellular creatures. There are vetebrates and a variety of invertebrates. Mammals have the orphan feature of mammary glands. The list could go on and on for orphan features and the groups they define. Now I use the phrase “orphan features” because I’m not comfortable using formal terms like autapomorphy or whatever. I actually don’t know what would be a good phrase.

So whenever I see an orphan feature that isn’t readily evolvable (like say a nervous system), I presume God did it, and therefore the similarities among creatures that have different orphan features is a the result of miraculous common design not ordinary common descent.

5,163 thoughts on “Common Design vs. Common Descent”

  1. Mung: Perhaps it is synapomorphies which define clades. And what is a synapomorphy? A shared apomorphy.

    An apomorphy is a character that is different from the form found in an ancestor, i.e., an innovation, that sets the clade apart (“apo”) from other clades. A synapomorphy is a shared (“syn”) apomorphy that distinguishes a clade from other organisms.

    https://en.wikipedia.org/wiki/Synapomorphy

    As I suspected, you misunderstand what you have read. Perhaps an example would help. The clade Tetrapoda has certain synapomorphies, including four legs. But snakes belong to Tetrapoda despite lacking those legs. See? Not definitional.

  2. Mung: I don’t see the pyramid case as analogous, but we’re not trying to explain the limestone, we’re trying to explain the Great Pyramid. Whatever explanation we choose, shouldn’t it explain the Great Pyramid by reference to physical/mechanistic causes? If your explanation for the Great Pyramid is not one that gives a causal explanation, what kind of explanation is it?

    What is it with creationists and analogies? I think it’s a perfectly adequate explanation for the arrangement of blocks in the Great Pyramid to say that people built it and arranged them that way.

    Are you saying that for the nested hierarchy we don’t need a causal explanation?

    No, I’m saying that common descent is a causal explanation. I’d say that people building the pyramid is a causal explanation too, but that’s not really relevant.

    Don’t just assert it, show it. But now you are saying that the nested hierarchy does require a causal explanation. Right?

    Common descent is a causal explanation for the nested hierarchy. What was I supposed to show?

    Causal explanations? Because you still haven’t answered what the alternative is.

    Alternative to what? I don’t understand what you’re trying to say there.

  3. Mung: ok, thanks. Out of deference, because I am sure you are far more qualified than I when it comes to phylogenetics. But you don’t say what does define a clade. Please don’t say synapomorphies. 🙂

    Monophyly defines a clade. Or you could say relationships define a clade. Literally. For example, the clade Aves is defined as the most recent common ancestor of Struthio camelus and Passer domesticus and all its descendants. What synapomorphies do is identify which species fit that definition.

  4. John Harshman: What is it with creationists and analogies?

    No idea. What sort of “creationist” do you think I am?

    I know you’ve had me on Ignore. Are you aware that I accept universal common ancestry and reject “common design” as being pretty much without content?

    John Harshman: Monophyly defines a clade.

    Monophyly is too generic as a definition. It doesn’t define anything in particular. Monophyly alone cannot distinguish or differentiate one clade from another.

    Now it may be the case that in order to qualify as a clade the taxons within the clade must be monophyletic, but it must be something else that “defines” the group.

    Monophyletic groups are typically characterised by shared derived characteristics (synapomorphies), which distinguish organisms in the clade from other organisms.

    https://en.wikipedia.org/wiki/Monophyly

    Define – delimit. Synonyms. Characterize. Delineate.

    http://www.thesaurus.com/browse/define

    Characterize – distinguish. Synonyms. Define. Delineate. Differentiate.

    http://www.thesaurus.com/browse/characterize

  5. Dr. Entropy, from my vantage point, you provided non-sequiturs, not the explanations I was looking for.

    If your fan club wants to consult your “expertise” on the matter further, they can, but I’m moving on for now. Thanks anyway.

  6. John Harshman: Common descent is a causal explanation for the nested hierarchy. What was I supposed to show?

    The request is that you show that Darwin made the claim that you said he made:

    John Harshman: Darwin’s causal explanation for nested hierarchy was common descent.

    This is an assertion that you put forth, and I’d like to know what it is based on.

  7. The reason I brought up some the issues of duplication etc. is that it is related to another matter, namely, changes in synteny (the way genes are laid out on a chromosome) and mechanisms involved in transplanting genes and non-coding DNA from one chromosome to another.

    https://en.wikipedia.org/wiki/Synteny

    In classical genetics, synteny describes the physical co-localization of genetic loci on the same chromosome within an individual or species. Today, however, biologists usually refer to synteny as the conservation of blocks of order within two sets of chromosomes that are being compared with each other. This concept can also be referred to as shared synteny.

    One thing also that is not reflected in gene trees. The sp100-rs chimera in the house mouse is not found in other mammals. Although I’m open to the idea it is functional, it’s not looking good for that gene. Furthermore, there are 2000 copies of it in some house mice, only 60 in other house mice. That isn’t reflected in the phylogentic gene trees, but it’s hard to run a way from the fact, it’s a pretty good diagnostic marker for someone wanting to build phylgenetic trees.

    Synteny order, the order of genes and non-coding regions is also a marker. It’s right now really expensive to do whole genome and chormosome-by-chromosome comparisons, but because synteny is stable in some species over time, this is also a good diagnostic marker and it raises issue as to how an organism can survive through synteny changes.

    Obviously creatures survive it since some creatures have very odd karyotypes, but as we’re learning, at some point the genome can’t be mangled too much without affecting something. The reason? Molecular transcription factories and topologically associated domains that are cell-type specific. These are 3-dimensional/4-dimensional regulatory mechanisms that are dependent on the 1-dimensional sequence of DNA.

    To understand what I mean, here is a 8-minute nice video on the topic involving the high-C experiments. I first learned of this at the ENCODE 2015 conference at the NIH and since then there has been money pouring into related explorations like the 4D nucleome (as in 4-dimensional nucleome) project. This also is a diagnostic marker for species groups.

    It’s also the sort of design the suggests foresight on the part of the designer rather than random mutation.

    So we hear about protein folding. There is also DNA folding and looping. This 8-minute rather entertaining video shows the importance of this.

    The narrotors mention “H3-K-36-tri-methylation”, that is one of those histone Random-Acess Memory changes that are coordinated simultaneously on several genes at a time, perhaps even on genes on different chromosomes!

    So when I look at this, I think, “God must have done it, because evolution can’t.”

    So in view of the material in that video, let’s look at the synteny comparison between mice and men. How’d that happen?! How can that happen without change the 4D operation of the DNA as shown in that video. This 4D operation of the DNA is the topic of the NIH 4D nucleome project…..

    Anyway back to synteny which is related to the 4D nucleome (like that depicted in the Hi-C video):

    Synteny between human and mouse chromosomes. Colors indicate homologous regions. For instance, sequences homologous to mouse chromosome 1 are primarily on human chromosomes 1 and 2, but also 6,8, and 18. The X chromosome is almost completely syntenic in both species

    click for larger image:
    http://theskepticalzone.com/wp/wp-content/uploads/2017/12/synteny.jpg

  8. Mung: No idea. What sort of “creationist” do you think I am?

    I know you’ve had me on Ignore. Are you aware that I accept universal common ancestry and reject “common design” as being pretty much without content?

    It’s hard to tell what you are because you never defend any sort of claim. And since you appear to reject all the evidence for common descent, I don’t understand on what basis you accept it. Could you clarify?

    Monophyly is too generic as a definition. It doesn’t define anything in particular. Monophyly alone cannot distinguish or differentiate one clade from another.

    Nevertheless, that’s the definition. Modern clade definitions are explicitly phylogenetic.

    Now it may be the case that in order to qualify as a clade the taxons within the clade must be monophyletic, but it must be something else that “defines” the group.

    The first clause in that sentence was word salad. But we appear to disagree on what “define” means. My theory is that things are defined by definitions.

  9. Mung: This is an assertion that you put forth, and I’d like to know what it is based on.

    The Origin, Chapter XIV is entirely about that.

  10. Mung,

    He really does seem to think that DNA replication takes place when one strand of DNA just magically happens to match up with another strand of DNA that just happens to be fortuitously floating around unattached at just the right time and place.

    That’s not what I learned about DNA replication, but WTHDIK.

    Hard to tell. Still, my own view (WTHDIK?) is that Entropy and DNA_Jock are speaking with a greater depth of knowledge than Sal or yourself on this topic. I don’t see how you conclude what you conclude about Entropy’s view of DNA replication at all. You may alreadyy be aware, but there are two main sources of tandem repeat; slippage in replication (the same short sequence replicated twice), and ectopic misalignment during homologous recombination. I wonder if this is the source of confusion, reading the one when the other is intended?

  11. stcordova,

    It’s obvious you didn’t understand the problem posed [..]

    I’m afraid I don’t either. You seem to be saying that there should be a constancy in tandem repeat numbers – if not, any anomalies call all ‘naturalistic’ mechanisms into dispute. I’m not sure why. There are obviously a number of factors, some which favour extension, and some restraint. There is no particular reason that all genomic regions must be subject to the same factors.

  12. stcordova,

    Or how about why alpha satelites repeats are only so abundant in the centromeric regions. Even Csink and Henikoff want to know.

    Don’t know what Csink and Henikoff think, but a pericentromeric location actually protects ‘selfish’ DNA from excision by crossover-based mechanisms. Crossover is mechanically restricted near the centromere, and tends to be avoided anyway because its function appears to be partially related to chromatid tensioning in meiosis, preventing disjunction of both chromatids into the same daughter cell as the homologues are teased apart. The centromere is the spindle attachment point, so crossovers could not perform this tensioning if sited there.

    Away from the centromere, you get the reciprocal action of crossover – not only can it increase copy number, it can decrease it. To the extent that runaway increase can be detrimental, deletions can be selectively advantageous. However, near the centromere, there is less opportunity for deletion, because less crossover occurs there.

    So – you will ask – how do you get repeats near the centromere in the first place? Well, possibly by migration. Fragments of DNA are in something of a state of flux, breaking off and being reincorporated elsewhere. There’s a nice example of this in the diagram below your ‘flower’ in the original paper, showing the combined pattern of a whole-genome duplication and subsequent migration.

    Any repeat that finds itself nestling near the centromere finds itself less often in competition with fewer-repeat alleles than those exposed to the full force of selection ‘out there’ on the stormy seas of frequent crossover, and so can be differentially retained in these quiet backwaters.

  13. stcordova: So when I look at this, I think, “God must have done it, because evolution can’t.”

    And that pretty much sums up the totality of ID-creationism. The quintessential method, fallacy, and conclusion, all in one.

    The IDcreationist method is:
    Step1: Look at it (and by it, we mean diagrams with technical/complicated looking arrows, components, abbreviations and numbers), feel how much it “looks designed”.
    Step2: Let this feeling of “oh man it’s so complicated” emotionally compel you to insist that evolution couldn’t have produced it.
    Step3: From this orgy of blatantly fallacious appeals to emotion/intuition, declare that the only option now is that an invisible magician must have literally thought it into existence from absolute non-being.

  14. stcordova,

    I’m not sure how gene order really helps you. Gene order changes with increasing genetic distance, and again with no apparent discontinuity. Not only do you insist that every isoform in supposedly related species must have been be precisely designed for its given purpose, the order of genes must as well, in that sticking a gene in a given place is absolutely vital for the form of that organism: a design decision.

    These ‘design decisions’ give exactly what common descent would give: a gradually increasing divergence over time from an accumulation of small changes. I see no reason to dismiss that as a possible – nay, probable – cause of the pattern.

  15. Allan Miller: Don’t know what Csink and Henikoff think, but a pericentromeric location actually protects ‘selfish’ DNA from excision by crossover-based mechanisms.

    There is also the hypothesis that the expansion of centromeric repeats helps the recruitment of kinetochore proteins and better attracts microtubules. which results in centromeric drive in female meiosis. I recall that supernumerary B-chromosomes use similar tricks.

  16. Corneel: I recall that supernumerary B-chromosomes use similar tricks.

    Again, just for those watching, you don’t mean “use” or “tricks” right?

    You mean something like the opposite of that, but creationists are just lucky that using the language is much more convenient for them than it is for materialists?

  17. phoodoo: Again, just for those watching, you don’t mean “use” or “tricks” right?

    Even you should appreciate that it is irresistible to refer to these stretches of DNA sequence as vicious little selfish rogue elements.
    That makes it much more fun, see.

  18. Allan Miller:

    WTHDIK

    Apparently more than Dr. Entropy. Your responses are at least clearer and more substantive and deal with issues more accurately.

    The issue of Tandem Repeats is more subtle than meets the eye. I suppose I developed an instinct for character strings since I had studied compilers and computer language processors and lexical analyzers a looong time ago and it was one of my early specialties as an engineer in the aerospace and defense industry….

    For starters, it might be helpful to compare and contrast the dispersed repeats and tandem repeats. They are not, strictly speaking mutually exclusive in terms of mechanism. There are the cut-and-paste transposons and then there are copy-and-paste transposons like Alus and other SINES, and then there are LINES like Line-1. There are mechanisms that specifically single out the transposon as a (dispersed) repeating unit.

    We do find tandem repeating Alus here and there. Such as here:

    https://www.researchgate.net/publication/226351106_Alu_Tandem_Sequences_Inhibit_GFP_Gene_Expression_by_Triggering_Chromatin_Wrapping

    So, if a sequence can be specifically recognized, then it can be copied.

    The telomeric regions have a special mechanism to make the tandem repeat copies of the telomeric sequence like TTAGGG for vetebrates. So that tandem repeat is explainable by mechanisms other than Unequal crossover homologous recombination. So that is yet another example where Dr. Entropy’s “explanations” of Unequal Crossover homologous recombination don’t work for the formation of tandem repeats.

    I also provided examples such as in Huntington’s disease where Dr. Entropy’s “explanation” failed again, and that was with Tri-nucleotide repeats caused by errant Mismatch Repair (MMR) mechanisms. I further gave evidence MMR was likely implicated in even larger repeat unit recombination (like the 275 bp zeocin associated repeat in the 2010 PNAS experiments that specifically refuted homologous recombination as a mechanism in specific scenarios). So much for his supposed depth of knowledge that you bragged about. His knowledge seems pretty shallow to me with respect to tandem repeats — about the level of Ken Miller and Dennis Venema’s depth regarding nylonase evolution….

    But before leaving the telomere tandem repeat, it’s worth mentioning, the telomere are different in different groups:

    From wiki and Telomere Database:

    Vertebrates Human, mouse, Xenopus TTAGGG
    Filamentous fungi Neurospora crassa TTAGGG
    Slime moulds Physarum, Didymium TTAGGG
    Dictyostelium AG(1-8)
    Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
    Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
    Paramecium TTGGG(T/G)
    Oxytricha, Stylonychia, Euplotes TTTTGGGG
    Apicomplexan protozoa Plasmodium TTAGGG(T/C)
    Higher plants Arabidopsis thaliana TTTAGGG
    Cestrum elegans TTTTTTAGGG[48]
    Allium CTCGGTTATGGG[49]
    Green algae Chlamydomonas TTTTAGGG
    Insects Bombyx mori TTAGG
    Roundworms Ascaris lumbricoides TTAGGC
    Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
    Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
    or G(2-3)(TG)(1-6)T (consensus)
    Saccharomyces castellii TCTGGGTG
    Candida glabrata GGGGTCTGGGTGCTG
    Candida albicans GGTGTACGGATGTCTAACTTCTT
    Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
    Candida maltosa GGTGTACGGATGCAGACTCGCTT
    Candida guillermondii GGTGTAC
    Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
    Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

    So some tandem repeats like telomeres have dedicated mechanism for their maintenance and replication and it is not Unequal Crossover homologous recombination in those cases, contrary to Dr. Entropy’s insinuations….

    But the question of tandem repeats arose in relation to the emergence of the 3 kilo base D4Z4 repeat and alpha satellite tandem repeats. D4Z4 copy number is important to health. Too little (below 11), and one gets muscular dystrophy. The average number of D4Z4 repeats is 100. I found that repeat specifically to argue against Larry Moran’s propensity for declaring things junk, D4Z4 is a functional repeat. So what is the mechanism for both variability and maintenance of D4Z4 to have mean copy number of about 100 in healthy individuals.

    Entropy said it was homologous recombination. I provided a few scenarios to highlight the problem with blindly assuming it is Unequal Crossover homologous recombination. I saw that problem with it almost the minute he tried to “explain” it.

    The problem isn’t that homolgous sequences can duplicate, the problem is identifying the same unit over and over when the unit is ALSO flanked by homologous sequences.

    Some counter-examples that show the fallacy in Dr. Entropy’s claims are demonstrated in the links below. You can tweak them and make up scenarios of you own. It will hopefully convey the problem that despite the fact Unequal Crossover can create duplicates (as well as delete duplicates), it doesn’t explain PREFERENTIAL duplication of a specific segment WITHIN a homologous sequence.

    Dr. Entropy’s mis-diagnosis of the problem emerges from the fact he did not account for the homology of the sequences FLANKING D4Z4. I tried to explain the mechanics of the problem, but he blindly assumed the problem was with me, whereas it was with him.

    I wasn’t very nice in reminding him of his failure to explain the issues by repeatedly (pun intended) demanding he explain why sp100-rs is preferentially repeated 2000 times more in the house mouse than any other typical gene. He could not explain the PREFERENTIAL amplification. His explanation was about as lame and non-sequitur as explaining how a book publisher preferentially decides to copy books based on the mechanics of the printing press. He totally missed the real issue at hand.

    Any way, here are my worked out examples that highlighted the failure of Dr. Entropy’s “explanations”:

    Common Design vs. Common Descent

    Common Design vs. Common Descent

  19. Allan,

    Ok, let’s visting the question is how a D4Z4 repeat is made in the genome. It’s 3 kilobases long, there are 100 repeats on average in a healthy human. For brevity, I’ll just use “D4Z4” to represent the repeat rather than the exact DNA bases. The tandem repeat should look like this:

    D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4…..

    The question is, how could that repeat come about by mutation if it started hypothetically like:

    actgactgactgD4Z4actgactgactg

    Try to do the repeat expansion by Unequal Crossover homologous duplication. It’s not as straightforward as you might think. You might think, “no problem” we can get it to evolve to:

    actgactgactgD4Z4D4Z4actgactgactg

    then

    actgactgactgD4Z4D4Z4D4Z4actgactgactg

    then

    actgactgactgD4Z4D4Z4D4Z4D4Z4actgactgactg

    etc till you get

    ….D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4….

    But it’s not as straight forward as that, and there are barriers to making it work as straight forwardly as that. Now that’s an assertion on my part so far, but does this sort of enlighten what is trying to be accomplished by an unequal crossover? If that makes sense, then we can walk through an example of where the problem lies with unequal crossover.

  20. For the record, notice that Salvador doesn’t understand the difference between a repeat unit of three bp, like “CAG” and one that’s 3000 bp long, like the D4Z4 repeat “unit,” which lead poor Salvador to think that I didn’t know that Huntington’s disease was due to slippage (despite I mentioned it, before Salvador did, twice), and that surely D4Z4 copy number variation must also be due to slippage.

    Of course, he asked for the prevailing mechanistic explanation for things like D4Z4, and I gave him that: unequal crossing over (non-allelic homologous recombination). However, Salvador then kept insisting that if a triplet varies by slippage, then the D4Z4 3000-plet varies also by slippage.

    I tried many times to explain the difference to Salvador, but his enormous talent at detecting patterns didn’t seem to help him make that distinction, or understand my explanations about that difference. It might be one of those counterintuitive things about intelligence, which makes it very hard for people as amazingly talented as Salvador to understand the difference between 3 and 3000, while mere mortals like myself don’t have such a hard time for something so apparently simple.

    Oh, but wait! Telomeres expand in a different way! Therefore, explaining to him that things like the D4Z4 repeat happens by unequal crossing over left telomeres out! How dare I explain what the question was about, instead of providing a compendium of all kinds of repeats and their origins!!!!!

    Please take a look at Salvador’s question:

    Dispersed repeats like transposons have a mechanism to explain them. Short micro satellite repeat (a few nucleotides) seem to have a good biochemical explanation. But what about long tandem repeats like D4Z4 in the dystrophin gene? That repeat is over 3 kilobases. It don’t believe it is a transposon. 100 such tandem repeats are normal for a healthy human, less than 11 D4Z4 repeats creates muscular dystrophy. How are the boundaries of the repeats so exquisitely defined through replication? I actually don’t know what the prevailing mechanistic explanation is.

    There you have it. In all its glory. Asking for the mechanistic explanation for repeats where each “unit” is ~3000 bp long, only to later insist that experiments involving tri-nucleotides, performed in bacteria, make non-allelic homologous recombination, in humans, pretty much non-existent.

    Oh! Salvador insisted on the “detection of exquisite boundaries,” which strongly suggested that he doesn’t understand what homologous recombination means and implies. That I noticed this detail made Salvador so mad that he forgot what his question was, focusing entirely on ignoring my answers, and claiming time and again that the demonstration of any other mechanisms, no matter how unrelated to his original question, meant that I was horribly wrong.

    The moral of the story: if you notice that Salvador has no idea about something, don’t tell him. It will make him irrationally and blindly mad. He will prefer ridiculing himself over learning the things he needs to learn in order to understand.

    Have a great day.

  21. Allan Miller:
    stcordova,
    I confess I don’t really know what you are saying here.

    He’s saying that telomeres expand in some fashion, gave you some examples of telomeric sequences, and that, because telomeres don’t expand by unequal crossing over, like D4Z4, I’m an ignorant fool.

  22. Well, there’s a downside to putting commenters on ignore.
    You can end up looking like an idiot.
    Moving on.
    Someone want to ask Sal if a Tetrahymena telomere [TTGGGG] would work in S. cerevisiae [TGTGGGTGTGGTG]
    But try to be subtle…

  23. stcordova: But it’s not as straight forward as that, and there are barriers to making it work as straight forwardly as that. Now that’s an assertion on my part so far, but does this sort of enlighten what is trying to be accomplished by an unequal crossover? If that makes sense, then we can walk through an example of where the problem lies with unequal crossover.

    I would explain this to you Sal, but you’d ignore my answers (again), and then you would insist that I didn’t explain anything, and that I’m wrong (interesting, I didn’t explain anything, but I’m wrong, wrong about what if I didn’t explain anything?) because there’s telomeres, centromeres, and try-nucleotides that expand in a different way. I wonder why you didn’t add transposons to the mix of things that expand differently? Oh! I see it now, you did!

    I might still make some diagram later, for the benefit of those who might care to read it (obviously not you), and because it might be helpful for the courses I teach.

  24. DNA_Jock,

    What does it look like when someone is in ignore? Do you see that there’s a comment, but you don’t see the comment? Do you see nothing from that user at all?

  25. Entropy,

    Yes, I got some of it – that there are mechanistic causes of repeat beyond strand slippage and crossover misalignment. That could have been said quite succinctly, indeed. Just not sure where it was all really going.

  26. Entropy:
    DNA_Jock,

    What does it look like when someone is in ignore? Do you see that there’s a comment, but you don’t see the comment? Do you see nothing from that user at all?

    Why don’t you try it? You just hit the “x” next to someone’s name, and just as easily hit it again to take the person off of ignore.

    Used to be that messages from a person on “ignore” didn’t appear with any indication at all (except on the “recent comments”), but now the name and date appear without the message, a big green “X” to click if you want to quit ignoring, and a box at the right saying “ignored.”

    Glen Davidson

  27. Dr. Entropy, do you agree that telomeric tandem repeats aren’t due to Unequal Crossovers? Oh well, yet another example where your hypothesis doesn’t work.

    Btw, what is the mechanism of preferential amplification of sp100-rs by 2000 copies? Corneel mentioned a theory involving selection. How is the preference, (not the mechanism of duplication), explained in terms of unequal crossover. NOTE: “mechanism of preference” is not the same as “mechanism of duplication.” But that issue also seems to just float over your head. Oh well, thanks for trying to offer you “expertise” in these discussions.

    I thought I was going to move on, but since Allan Miller joined the discussion and he had some questions, I guess I’m going to have to beat your dead horse of a theory a bit more.

  28. stcordova: Dr. Entropy, do you agree that telomeric tandem repeats aren’t due to Unequal Crossovers? Oh well, yet another example where your hypothesis doesn’t work.

    See what I said? Salvador thinks that because I didn’t mention every way in which things, other than those like D4Z4, might expand, then I surely thought that every expansion was due to unequal crossing over. There you have it, Salvador in all his talented glory.

    I appreciate his kindness in making my point though.

  29. I don’t know how a mechanism that can create 2 repeats could be inherently unable to generate many more – and, indeed, in quite short order, if selection does not oppose it.

    All one needs in the first instance is a sequence that sits in one place on one chromosome, somewhere else on another. Active transposition and gene migration are both possible candidates. Then, through unequal crossover you can generate a repeat/deletion of the entire region between the two positions.

    Then you’ve got a possibility of further misalignment and further copies. Extension need not be one repeat at a time – how many repeats are generated in total depends on which copies are misaligned; there is a theoretical minimum number of replications needed to get to a particular repeat count. It doesn’t seem all that hard.

  30. Entropy: He’s saying that telomeres expand in some fashion, gave you some examples of telomeric sequences, and that, because telomeres don’t expand by unequal crossing over, like D4Z4, I’m an ignorant fool.

    So he’s only half right?

  31. Allan Miller,

    Sal actually picked some interesting examples where selection seems to a major player. If D4Z4 repeat numbers drop below a certain threshold, carriers are at risk of developing muscular dystrophy. Another one is a fusion gene in mice, sp100-rs, that has rapidly expanded to such high numbers in some populations that the repeat region is visible in cytogenetic staining. There was a paper showing some segregation distortion going on in crosses in favor of the repeat region. I thought that would be right up your alley.

    I believe Sal is looking for “poofamorphies” so we may get a rapid succession of even more repeat types until we reach one we can’t explain. Buckle up.

  32. stcordova:
    Dispersed repeats like transposons have a mechanism to explain them. Short micro satellite repeat (a few nucleotides) seem to have a good biochemical explanation. But what about long tandem repeats like D4Z4 in the dystrophin gene? That repeat is over 3 kilobases. It don’t believe it is a transposon. 100 such tandem repeats are normal for a healthy human, less than 11 D4Z4 repeats creates muscular dystrophy. How are the boundaries of the repeats so exquisitely defined through replication? I actually don’t know what the prevailing mechanistic explanation is.

    This is so strange Chava. I keep reading it, and I keep understanding that you’re asking specifically about things like D4Z4. I squint, and squint. I move the computer sideways. I change the light source. Yet, I still don’t see where you ask for an explanation for each and every kind of tandem expansion. I keep seeing “But what about long tandem repeats like D4Z4 in the dystrophin gene? That repeat is over 3 kilobases.”

    Not only that, I keep reading in there that you already understand other kinds of expansions (like transposons and short micro-satellite repeats), which lead me to think you were serious about the specific kinds of repeats you wanted to know about.

    Not only that, I keep reading that you’re worried about those “boundaries,” which would mean that you really meant the mechanism for their expansion. However, you meant the expansion of all kinds of repeats, and you wanted the mechanism to also explain why some regions expand and not others.

    I just cannot see your “real” questions there. So. I answered what you seemed to ask, rather than what you really wanted to ask. Sorry Chava.

    My problem must be a lack of that amazing talent of yours for detecting patterns.

  33. Corneel,

    Yes, I vaguely recall something about copy number variants and segregation distortion from Genes in Conflict. I’ll dig it out.

  34. Allan:

    I don’t know how a mechanism that can create 2 repeats could be inherently unable to generate many more – and, indeed, in quite short order, if selection does not oppose it.

    Here are two sequences. How many possible homolgous segments do you see shared between the two sequences? Quite a lot!

    1. actgactgactgD4Z4actgactgactg
    2. actgactgactgD4Z4actgactgactg

    To see what I mean, one of the homologous segments is obviously the entire sequence, but then you have segments like:
    “Z4actgactgac” or “gactgD4Z4a”, not just “D4Z4”.

    Unequal crossover can duplicate (delete) a variety of homologous segments shared by the two sequences, not just “D4Z4”. It’s perfecly capable of duplicating “Z4actg” as well.

    The problem is creating a preference for “D4Z4” in each round of unequal crossover. What is the mechanism for “D4Z4” to be consistently targeted as THE homologous segment between each round of supposed expansion? That’s a rhetorical question.

    Unless you can guarantee the same repeat unit is preferentially targeted over other possible homologous segments shared between sequences, it makes it pretty hard to duplicate the sequence in short order as you suppose.

    Try working out an example with two homologous sequences below undergoing crossover. Randomly pick out possible homologous segments in each round of unequal cross over. If you keep singly out “D4Z4” you are making a preference for that segment over the other possible segments that have homology between the two sequences. If you do that, you have to account for the mechanism of preference for “D4Z4” vs. another segment like say “Z4actg” in the multiple rounds of Unequal Crossover. Do you see the issue yet?

    The problem, dare I say, is you are thinking teleologically when you should be thinking “random mutation.” 🙂

  35. Thus, common design – the intentional reuse of a common blueprint or components – is a viable explanation for the widespread functional similarities among the biomolecules found in different types of organisms.

    – Theistic Evolution. p. 378

    I now consider the matter settled.

  36. stcordova: Unequal crossover can duplicate (delete) a variety of homologous segments shared by the two sequences, not just “D4Z4”. It’s perfecly capable of duplicating “Z4actg” as well.

    Holy mackerel! All those different options, and you manage to plump for one that HR cannot duplicate! Great GSW to the foot!
    HR could duplicate (actg)[1-3]D4Z4(actg)[1-3] eight different ways. BUT NOT anything with a breakpoint inside “D4Z4”. Seriously Sal, try this with text, but remember: the cross-over occurs within a region of homology.

  37. I wrote to Sal:

    You were talking about tandem repeats, like D4Z4, and you made a really, really dumb statement, to wit: “For a repeat to be actually nicely copied, somehow the repeated unit needs to have a means of identifying the start and stop of the repeat.”
    In fact, for a repeat to be “nicely” copied, (“precisely” copied, even) all that has to happen is that somewhere in the middle of the repeat ‘recognizes’ the corresponding spot in a different repeat. This process is homology-driven, and leads to either gene conversion or cross-over, depending on how the resulting Holliday is resolved.

    Sal complains

    Entropy said it was homologous recombination. I provided a few scenarios to highlight the problem with blindly assuming it is Unequal Crossover homologous recombination. I saw that problem with it almost the minute he tried to “explain” it.

    I’ll admit it, I was “blindly” assuming that it was homologous recombination. It’s the only explanation that makes any sense.
    But, good news, folks!
    Because there’s a lot of mosaicism in FSHD, researchers have actually been able to test this and as it turns out [drumroll please] my intuitions are better than Sal’s:

    The results of the present study strongly suggest that most mitotic D4Z4 rearrangements occur via an interchromatid gene conversion mechanism without crossover in which the donor allele remains unchanged, since the majority of mosaic patients with FSHD carry two distinct cell populations: one that encompasses the parental-sized D4Z4 alleles prior to rearrangement and one that encompasses the de novo disease-causing D4Z4 allele.

    And

    The presence of two rearranged D4Z4 repeats in 3 of 11 mosaic families with FSHD is indicative of the relatively frequent occurrence of gene conversion with interchromatid crossover

    Just like I said.
    Some debate follows as to whether this is recombination via SDSA or via DSB repair. For purely personal reasons, I am a fan of the DSB model .
    [Spoon-feeding poor Sal is getting old; this time he’ll have to read the review and the references therein to find this text. Heh.]

    ETA or google, dammit. fixed links too.

  38. Allan,

    There are things like Recombination Hotspots which give preferential treatment to certain regions of DNA like say the homologous regions between copies of a chromosome during meiosis.

    The mechanisms of this involve (gasp) histone modifications to mark out the place for preferential recombination. But, that’s just plain vanilla recombination. That doesn’t say much about unequal crossover, but that is the first hurdle.

    If something like D4Z4 is specifically targeted to be THE homologous sequence to be subject to unequal crossover, it would have to involve mechanisms to single it out repeatedly. That’s what I was after.

    But the PNAS 2010 paper I cited early explained tandem repeat units much longer than Okazaki fragments appear to be preferentially singled out perhaps for the mere fact that they are repeating! It was a very interesting experiment. The mechanism of repeat and instability at tandem repeats was slippage associated with mismatch repair (MMR) — homologous recombination was specifically ruled out as the mechanism in that experiment.

    So I was after experimentally demonstrated mechanisms to the extent we have any data on them. Dr. Entropy didn’t find that PNAS paper on MMR, I did. He might have stopped looking because he was so sure he figured everything out.

    Me on the other hand, was more skeptical, and I kept looking and I found stuff he didn’t even address.

  39. BTW Sal, before you get too excited, the authors do note that what they deem “interchromatid gene conversion mechanism without crossover” could equally be intrachromatid recombination with crossover…

  40. Hmm, from the pages of the Prestigous Journal Nature Reviews Genetics:
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2864001/

    Mechanisms of change in gene copy number

    Deletions and duplications of chromosomal segments (copy-number variations or CNVs) constitute a major source of variation between individual humans, underlying human evolution and many diseases from mental illness and developmental disorders to cancer. CNVs form at rates far outstripping other kinds of mutagenesis, and appear to do so by similar mechanisms in bacteria, yeast, and human
    ….

    Based on the evidence favouring replicative mechanisms, the known enzymology of DNA transactions in model organisms, and the evidence presented above concerning the potential involvement of stress responses in altering the availability of DNA repair proteins, we suggest that a mechanism like MMBIR presently constitutes our best working hypothesis for most events of copy number change.

    Looks to me, someone in this discussion is gettin’ a whuppin, and it ain’t me. 🙂

  41. Yeah, this business about gene conversion vs crossover: it’s worth a mention that all recombination also involves a bit of gene conversion. In resolving the DSB there’s a bit of nibbling away the hanging ends and resynthesis against the homologue.

    The machinery actually has no information about which was which parental strand when resolving a Holliday junction – the 4-way joining of two double strands. It doesn’t ‘know’ whether it’s going to crossover or not. What it does is make two … uh … ‘random’ snips in the 4 strands, and the relative polarity of those snip pairs determines whether the product is crossover or non-crossover. So in order to generate 1 crossover per bivalent, it needs to initiate 2 DSBs. On the average, one would be a ‘mere’ gene conversion, the other gene conversion + reciprocal crossover.

  42. Sal, site rules require that I assume that the reason you omitted the beginning of the Conclusion that you quoted was due to a failure to understand what you were reading, viz:

    There are at least two main mechanisms for change in copy number: NAHR and microhomology-mediated events. NAHR can be formed either by classical HR-mediated DSB repair via a double Holliday junction, or from BIR, which restarts broken replication forks by HR. However, the LCRs that mediate NAHR were presumably formed predominantly by the same mechanism as non-recurrent copy-number changes that are being formed now. Thus the mechanisms of microhomology-mediated copy number change underlie most copy-number change. Based on the evidence…

    NAHR is “non-allelic homologous recombination”, a precise term for what Entropy, Allan, and I have been pointing out as the (almost certain) source of the D4Z4 repeats.
    What the authors are saying here is that first step for any repeat, creating a Low Copy number Repeat (LCR) presumably occurred by the same mechanism that we observe today for the generation of non-recurrent (i.e. not tandem repeats) copy number changes today. “Underlie” means how they got their start as repeats, not how they propagate.
    The authors agree with Entropy, Allan, and I about what happens next; they even offer a handy-dandy bullet point summary.
    The first bullet:

    Copy number variants (CNVs) arise by homologous recombination (HR) between repeated sequences (recurrent CNVs). Or by non-homologous mechanisms that occur throughout the genome (non-recurrent CNVs).

    In other words, when repeats vary in copy number, its NAHR, when non-repeats vary, it’s non-homologous recombination.
    (P.J.Hastings has been promoting his recombination theory and the importance of microhomology for over 30 years now. He also spoke at CSHSQB in 1984, so it might have been during his talk that Jim Watson was checking out Sue’s ass.)

  43. stcordova,

    Same fucking review cited by Chava above:

    It is likely that recurrent CNVs arose by homologous recombination between repeated sequences. This process is called non-allelic homologous recombination (NAHR), and is discussed further below.

    The part quoted by Chava is about the origin of the first few replicas (LCRs: Low Copy Repeats), not about recurrent CNVs. In other words, it’s about ways in which the first few replicas might form, and these authors propose the micro-homology mediated processes as the most likely one:

    the LCRs that mediate NAHR were presumably formed predominantly by the same mechanism as non-recurrent copy-number changes that are being formed now

    Someone in this discussion is gettin’ a self-inflicted whuppin, and it certainly is Chava Cordova, who cannot understand the articles that he quote-mines.

Leave a Reply