Common Design vs. Common Descent

I promised John Harshman for several months that I would start a discussion about common design vs. common descent, and I’d like to keep my word to him as best as possible.

Strictly the speaking common design and common descent aren’t mutually exclusive, but if one invokes the possibility of recent special creation of all life, the two being mutually exclusive would be inevitable.

If one believes in a young fossil record (YFR) and thus likely believes life is young and therefore recently created, then one is a Young Life Creationist (YLC). YEC (young earth creationists) are automatically YLCs but there are a few YLCs who believe the Earth is old. So evidence in favor of YFR is evidence in favor of common design over common descent.

One can assume for the sake of argument the mainstream geological timelines of billions of years on planet Earth. If that is the case, special creation would have to happen likely in a progressive manner. I believe Stephen Meyer and many of the original ID proponents like Walter Bradley were progressive creationists.

Since I think there is promising evidence for YFR, I don’t think too much about common design vs. common descent. If the Earth is old, but the fossil record is young, as far as I’m concerned the nested hierarchical patterns of similarity are due to common design.

That said, for the sake of this discussion I will assume the fossil record is old. But even under that assumption, I don’t see how phylogenetics solves the problem of orphan features found distributed in the nested hierarchical patterns of similarity. I should point out, there is an important distinction between taxonomic nested hierarchies and phylogenetic nested hierarchies. The nested hierarchies I refer to are taxonomic, not phylogenetic. Phylogeneticsits insist the phylogenetic trees are good explanations for the taxonomic “trees”, but it doesn’t look that way to me at all. I find it revolting to think giraffes, apes, birds and turtles are under the Sarcopterygii clade (which looks more like a coelacanth).

Phylogeny is a nice superficial explanation for the pattern of taxonomic nested hierarchy in sets of proteins, DNA, whatever so long as a feature is actually shared among the creatures. That all breaks down however when we have orphan features that are not shared by sets of creatures.

The orphan features most evident to me are those associated with Eukaryotes. Phylogeny doesn’t do a good job of accounting for those. In fact, to assume common ancestry in that case, “poof” or some unknown mechanism is indicated. If the mechanism is unknown, then why claim universal common ancestry is a fact? Wouldn’t “we don’t know for sure, but we believe” be a more accurate statement of the state of affairs rather than saying “universal common ancestry is fact.”

So whenever orphan features sort of poof into existence, that suggests to me the patterns of nested hierarchy are explained better by common design. In fact there are lots of orphan features that define major groups of creatures. Off the top of my head, eukaryotes are divided into unicellular and multicellular creatures. There are vetebrates and a variety of invertebrates. Mammals have the orphan feature of mammary glands. The list could go on and on for orphan features and the groups they define. Now I use the phrase “orphan features” because I’m not comfortable using formal terms like autapomorphy or whatever. I actually don’t know what would be a good phrase.

So whenever I see an orphan feature that isn’t readily evolvable (like say a nervous system), I presume God did it, and therefore the similarities among creatures that have different orphan features is a the result of miraculous common design not ordinary common descent.

5,163 thoughts on “Common Design vs. Common Descent”

  1. DNA_Jock: I was standing next to Jim Watson, and he spent the entire session checking out her ass. I mean full on Harvey Weinstein.

    Perhaps he was just admiring the complementary pairing. For scientific reasons.

  2. Allan Miller: I got “we use cookies to improve your experience with the site”. Perhaps I might try that as an incentive.

    Have you figured out how to turn on a cookie yet?

  3. Entropy:

    Both DNA_jock and me have explained this to you at large.

    Well, I guess I missed your explanation.

    Why is sp100-rs tandemly repeated 2000 times more than other genes. The tandem repeats seem rather recent too because of the lack of divergence. You could set the record straight. Here is the template:

    Entropy explains how homologous recombination singles out Sp100-rs:

    Even though all genes are subject to homologous recombination,
    sp100-rs is tandemly repeated 2000 more than other genes because ________

    You fill in the blanks.

    Explain for the readers why a chimeric newcomer gene like sp100-rs, not found in other mammals, is singled out for repeat instead of other genes based on homologous recombination. Why does homologous recombination explain the 2000 fold duplication of sp100-rs and the non-duplication of other genes?

    Yeah, I’m really so dense and illeratate. That’s sooooo true. So you gotta help me figure out how that 2000 fold repeat happens for one gene and not another. I mean, aren’t other genes subject to homologous recombination too? Why aren’t there 2000 copies of those other genes as well? Why not more than 2000 since they are more ancient than the Sp100-rs chimera?

    You gotta help me figure this out so we can do proper Neighbor Joining and group that nested hierarchy the right way.

  4. stcordova: Entropy didn’t address that issue, but he seemed to keep focusing on rote complementarity instead of the real issue.

    He really does seem to think that DNA replication takes place when one strand of DNA just magically happens to match up with another strand of DNA that just happens to be fortuitously floating around unattached at just the right time and place.

    That’s not what I learned about DNA replication, but WTHDIK.

  5. stcordova: Well, I guess I missed your explanation.

    But you could browse back and read. Right? You wouldn’t lose a finger if you did just that. Right?

    I already answered your question. DNA_jock answered it too. Then Corneel (but you failed to read Corneel’s next sentence and asked a question that the sentence already answered).

    Browse back. read complete sentences and paragraphs and comments. Try and make sense of them. If you can’t, then you don’t have the background to understand. Admit that to yourself (I don’t care about you admitting it to me), and do something about the background. You’re embarrassing yourself at levels you cannot possibly imagine.

  6. stcordova: Are you saying it was by chance that Sp100-rs was singled out as the one that got amplified 2000 times over other genes?

    I am not familiar with that example, so all I can say now is that once several duplications have occurred, the chance of unequal crossing over is increased, which is expected to generate variation in the number of repeats.

    stcordova: And fwiw, can’t unequal crossover reduce copy number since one segment must lose for another to gain.

    Haha. Yes it does Sal. There are a few mechanisms that can affect the frequency of particular alleles in a population though. I daresay they might even get a mention once in a while here at TSZ.

  7. Entropy,

    I know what, since I can’t seem to find your answer, maybe someone else will quote your post as to how Sp100-rs has 2000 copies more than other genes that had been around a lot longer in Mus Musculus (house mouse). They can quote the section where you explain how homologous recombination and complimentary strands favor the 2000 fold duplication of Sp100-rs over other genes in the house mouse. Soooo, since I’m soooo illiterate, maybe someone else will.

    In the meantime, a very interesting set of experiments that demonstrated the LACK of the role of homologous recombination in the variability of tandem repeats. It was very interesting in that a tandem repeat in one location affected the duplication or deletion of a tandem repeat at another location. They argue Mismatch Repair (MMR) over homologous recombination as an explanation.

    http://www.pnas.org/content/107/52/22582.full?sid=04400978-3e57-4328-bca5-1307fb29d48e#F2

    Discussion

    We asked the question: Does one class of repetitive DNA influence the stability of another and, if so, how does it carry out this action? This work demonstrates that, in an E. coli model system, a CAG·CTG TNR array stimulates instability of a 275-bp tandem repeat located up to 6.3 kb away. This reaction is independent of the hairpin endonuclease SbcCD (Mre11/Rad50), homologous recombination, and RuvAB-dependent RFR, providing no evidence for the formation of a DSB as a consequence of cleavage or RFR. By contrast, our data show that MMR at the TNR array stimulates instability at the 275-bp tandem repeat.

    We confirmed, by using TNR instability assays, that MMR mutants display an elevated frequency of +1 and −1 repeat unit changes, implying that CAG·CTG repeats can form loop-outs composed of a single trinucleotide unit on the template or on the newly synthesized strands of replication. We propose that these loop-outs are recognized by the MMR system that removes them by a process that involves the formation of ssDNA by UvrD helicase following a ssDNA nick generated by MutH and that it is the repair of this ssDNA that results in recombination of the tandem zeocin repeats, via strand slippage as shown in Fig. 2C, i.

    http://www.pnas.org/content/107/52/22582.full?sid=04400978-3e57-4328-bca5-1307fb29d48e#F2

  8. stcordova,

    Curious, all you have to do is click on “Older Comments” then use the “find” or “search” function in your browser to find the word “Entropy.” Must be too hard for an illiterate like yourself.

    I’d explain this in Spanish, but I think your problem is not the language, but the lack of an appropriate educational background. To genetic illiteracy we should add computer-browser illiteracy, besides laziness to go back and read, even though those comments were directed to you, but you thought it was all right to ignore them and continue posting things in an attempt to distract from your failures by introducing other failures.

    You must be very very proud of yourself.

  9. I wrote here to Corneel:

    Common Design vs. Common Descent

    Thank you so much for pointing out my error. I would presume slippage can’t account for repeats larger than something like an Okazaki fragment.

    Well, maybe I issued a retraction too hastily because of the mutations inadverdently induced by Mismatch Repair (MMR):

    http://www.pnas.org/content/107/52/22582.full?sid=04400978-3e57-4328-bca5-1307fb29d48e#F2

    The long distance over which the stimulation of tandem repeat recombination can be propagated (6.3 kb) argues for the formation during MMR of single-stranded regions considerably longer than Okazaki fragments.

    Could that long single strand be repaired to double strand status?

  10. stcordova,

    Oh, that paper is about short repeats, and it’s about bacteria. You asked questions about long repeats, gene-size ones, in humans. You then admitted, to Corneel, that those might not happen by slippage. Now you go back to short repeats, in bacteria, to prove me wrong abut those long tandem duplications in humans.

    You can’t help yourself, can you? You have to embarrass yourself no matter what. What do you think you accomplish besides ridiculing yourself?

  11. Entropy:

    I’d explain this in Spanish, but I think your problem is not the language, but the lack of an appropriate educational background. To genetic illiteracy we should add computer-browser illiteracy, besides laziness to go back and read, even though those comments were directed to you, but you thought it was all right to ignore them and continue posting things in an attempt to distract from your failures by introducing other failures.

    You must be very very proud of yourself.

    Me too dumb, me too lazy to read your non-explanations that have already been refuted experimentally by the paper I just cited from the prestigious National Academy of Sciences by John K. Blackwood, Ewa A. Okely, Rabaab Zahra, John K. Eykelenboom, and David R. F. Leach.

    http://www.pnas.org/content/107/52/22582.full?sid=04400978-3e57-4328-bca5-1307fb29d48e#ref-15

    We conclude that CAG·CTG TNRs stimulate tandem repeat instability by a mechanism such as strand slippage that is independent of homologous recombination.

  12. stcordova,

    Sure Sal. A paper that tested a particular kind of events, involving repeats each of very short length, tested in a model bacteria, which might happen very little in humans (according to the paper), refutes the well-established events of non-allelic homologous recombinations behind lots of copy number variations of large segments in the human genome.

    Anybody who has the literacy to search for our previous answers, and who might care, will do. They will succeed where you just claim, out of laziness and illiteracy, that the answers do not exist. What do you think that makes you look like? Who do you think you’re fooling other than yourself?

    P.S. Well, if it was published in PNAS, then it refutes everything you want it to refute, rather than relate solely to what was tested in the article. The Journal is more important than the objectives and experiments performed. At least in your fantasy-world.

  13. Entropy:

    Sure Sal. A paper that concludes that these kinds of events, involving repeats each of of very short sequences,

    Hmm. 275 bp isn’t eactly short! The TNR’s are short, but the experiment showed TNR in one region can induce effects on 275 bp tandem repeat in another region.

    As far as your complaint about the paper not being applicable to humans, that PNAS paper specifically cites the Mistmatch Repair (MMR) involved in Huntington’s disease as partly the motivation for the paper.

    That MMR mechanism is contrary to that wiki entry that invoked homologous recombination to explain Huntington’s disease.

    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2681094/

    …these data imply that the mismatch repair complex physically or functionally cooperates with OGG1 to promote expansion of the CAG repeat sequences.

    So since me so iwitiwate, ain’t a human a Eukaryote? Don’t that mean mismatch repair is implicated in CAG tandem repeats expansion in Huntington disease? Don’t that mean you and Wiki were wrong to cite homologous recombination as explanation for Huntington disease CAG tandem repeat copy expansion?

    Were you just wikipeeing instead of reading primary sources like the ones I cited? If wikipedia is wrong on a topic, it’s a bad idea to be wikipeeing in public like you did.

  14. stcordova: As far as your complaint about the paper not being applicable to humans, that PNAS paper specifically cites the Mistmatch Repair (MMR) involved in Huntington’s disease as partly the motivation for the paper.

    But they conclude that they’re not sure that the events they found do apply. It still doesn’t matter Sal. You’re missing the point: It was about short repeat “units,” not about things like the events we were initially talking about, which are much much longer than three nucleotides each. Leaving aside that they could not possibly check for unequal crossing over in Escherichia coli, right? Oh, you didn’t know that? Of course not.

    Bessides, I told you that slippage was behind the Hutchinson disease repeats yesterday! and that it doesn’t apply very well to tandem repeats of long elements.

    stcordova: Were you just wikipeeing instead of reading primary sources like the ones I cited? If wikipedia is wrong on a topic, it’s a bad idea to be wikipeeing in public like you did.

    Nope. I explained everything from my own knowledge. I teach this stuff Sal.

    You cited primary literature without even understanding it. Hell, you keep citing this article as if it’s about those long repeats, when you should know that the “unit” in the tandem repeat in Hutchinson disease is one codon long!

    Did you even attempt to read those articles or did you just hunt for quotations? If you can hunt for quotations, how come you cannot browse back and read those explanations we already gave you?

  15. Entropy,

    P.S. I explained, though, in my very first explanation, that once you have some repeats within region, the opportunities for the region to suffer lots of copy number variation increase

    Do you have a citation to support this?

  16. Entropy said:

    I explained, though, in my very first explanation, that once you have some repeats within region, the opportunities for the region to suffer lots of copy number variation increase

    Not much of an explanation since mammalian genome have huge numbers of repeats especially in the non-coding region, and thus that doesn’t explain why sp100-rs in the house mouse has 2000 more repeats than the other genes surrounded with repeats (like SINES) . No thank you for you your non-explanations. They were extremely unenlightening.

    It’s obvious you didn’t understand the problem posed, and you can’t cite anything except a Wikipedia entry relying on an obsolete 1982 description of the tandem repeats in Huntington’s disease! Contrast that to the article I cited that is almost 3 decades later that involves actual experiments that showed homologous recombination wasn’t the mechanism.

    So explain to colewd why you think sp100-rs has 2000 more repeats than another gene.

  17. The issue of tandem repeats is actually relevant to building phylogenetic nested hierarchies the right way.

    Alpha satellite repeats in the centromeric regions are distinctive to species groups. They provide synapomorphies that don’t work really well with the gene tree building programs that I’ve showcased here and are discussed at length in Joe’s book.

    These alpha satellite repeats echo a theme I’ve emphasized, namely it’s cherry picking to look at individual genes one at a time that are represented in all the species under question. It is far more powerful to identify differences between species that set them apart — as in giraffes have placentas and fish don’t.

    Additionally, alpha-satellite tandem repetitive DNA in the centromeric regions is very compelling and raises profound paradoxes and synapomorphies if not outright POOF-omorphies.

    Csink and Henikoff describe the problem which floated right over Enrtropy’s head. The state quite well the problem I was highlighting which Entropy doesn’t even realize exists:

    But then why is it that satellite blocks are not found throughout the chromosome rather than being confined primarily or exclusively to pericentric regions?

    Tandem repeats might expand anywhere on a chromosome because of sloppiness in the replication or recombination machinery, but
    large expansions persist predominantly in the vicinity of the centromere.

    Remarkably, centromeres themselves are composed almost entirely of tandem repeats in organisms as diverse as Arabidopsis thaliana,
    Drosophila melanogaster and Homo sapiens.

    It is paradoxical that the centromere, the only locus that must be present once and only once on every chromosome during every cell division, since the very beginning, is composed of and surrounded by such short-lived DNA.

    Csink and Henikoff

    The reference to “short-lived DNA” is that the repeat it is not evolutionarily conserved across species! It is a pretty good molecular synapomorphy, maybe even a POOF-omorphy. The title of their paper was properly called:

    Something from nothing: the evolution and utility of satellite repeats

    Here is a link to the abstract of that paper
    https://www.ncbi.nlm.nih.gov/pubmed/9613205

    “Something from nothing.” Sounds like a POOF-omorphy.

  18. colewd:
    Entropy,
    Do you have a citation to support this?

    Think about it Bill. If you have several repeated sequences next to each other, would it increase the number of position where the wrong recombination can happen or not? If those potential misalignments increase, would more wrong recombinations be likely to happen or not?

    During crossing over, strands break and recombine between sister chromosomes. If repeats are sufficiently close to each other, then the accidents are bound to happen. The more repeats the higher the probability. For obvious reasons.

    Do you understand why or not? if not, what is it that you don’t know? That DNA strands pair with complementary strands? That there would be more than one complementary strand if we have repeated elements in the chromosome? That some of those complementary strands would be the “wrong” ones when considering a “perfect” alignment between DNA sequences?

    Think about it and make sure you pinpoint what you might be missing. Look for unequal crossing over, or for copy number variation to see if that helps. Then come back and ask if still not clear.

  19. stcordova,

    Sorry Sal. I quit on you.

    I have a huge doubt though.

    You know that you’re ignorant about this and that you really don’t understand something as basic as the difference between tandem repeats involving three nucleotides and tandem repeats involving units of thousands of base-pairs long. That might you don’t even understand what base-pairing refers to, that you don’t understand that bacteria don’t perform crossing over, that you don’t know what complementarity means. You know this. You won’t admit this to me openly (though you make sure that I figure it out), but you know that you’re horribly ignorant of this stuff.

    Yet, somehow you think that by quoting from some articles that you don’t understand, you can save face when talking to people who do understand them. You don’t even know if what you quote means what you think it means. So. How does this work in your head? How exactly does it play in your head? I mean, how can you possibly think that your ignorance won’t shine if you just quote-mine from some primary literature without actually understanding what those articles are talking about? How? How does it play in your head? How do you imagine that you can show those evil geneticists that you know genetics better than them, even though you have no idea?

    I’m authentically curious.

  20. Entropy,

    Maybe you could give an explanation to colewd why a malfunctioning gene like sp100-rs (created by gene fusion mutation of two other genes) has 2000 copies whereas as more ancient genes only have one copy. 🙂

    Or how about why alpha satelites repeats are only so abundant in the centromeric regions. Even Csink and Henikoff want to know. That might explain the evolution of “something from nothing”.

  21. stcordova: the repeat it is not evolutionarily conserved across species! It is a pretty good molecular synapomorphy, maybe even a POOF-omorphy.

    Hi Salvador,

    What’s your term for a shared poofamorphy? Is it a poofanapy?

  22. stcordova,

    I’ll explain those things to Bill as needed. Unlike you, Bill is sufficiently self-aware that he doesn’t presume of expertise when he knows he’s lacking. That’s a much better attitude than your prideful display of unsurmountable ignorance.

    I read all your comments since we started the repeats discussion. I answered them. You haven’t had the courtesy of reading my answers. That means that my words are wasted on you. I doubt that you have any background for understanding anyway, so I’m not trying any more. You’re a lost cause.

    Now, what about my question: how does that play in your mind? You have no idea, yet you think that mere quote-mines will triumph where knowledge is required. How dose it play in your mind? How do you justify that kind of attitude on your part? Do you think, “nah, nobody will notice that I didn’t read the article”? What do you think?

  23. Entropy:

    Hell, you keep citing this article as if it’s about those long repeats, when you should know that the “unit” in the tandem repeat in Hutchinson disease is one codon long

    But just to set the record straight, you’re conceding the multiple tandem repeats and copy number variations implicated in Hutington’s disease aren’t the result of Homologous Recombination and Unequal Crossover. Is that right? Colewd and Mung might be interested to hear your concession.

  24. Entropy:

    That’s a much better attitude than your prideful display if unsurmountable ignorance.

    You can surmount my ignorance.

    Explain why the sp100-rs gene in mice has 2000 copies, and most of the other genes have only 1 copy. How does homologous recombination explain the preferential copying of a broken gene like sp100-rs to the exclusion of the other genes?

    That’s obviously relevant to the question of alpha-satellite repeats that are probably in the thousands and concentrated in the centromeric regions.

  25. stcordova: So explain to colewd why you think sp100-rs has 2000 more repeats than another gene.

    Sal, I (and others) tried to hint to you why certain alleles tend to spread in the population. It usually involves some good ol’ natural selection.

    I looked into the sp100-rs repeat, which appears to be a chimeric fusion protein. In some mouse populations, the repeat region is large enough to show up as a homogeneously staining region (HSR) on chromosome 1 in cytogenetic research. And now for the interesting part: There is some evidence that this region acts as a segregation distorter that favors its own transmission, shown here. That would certainly explain why the repeat region got so excessively large; large repeat regions are strong drivers of segregation distortion.

    Now, the research is quite old, and I have been unable to find more recent publications confirming those findings, but it certainly goes to show that natural selection should be among the explanations you are looking into.

  26. stcordova: But just to set the record straight, you’re conceding the multiple tandem repeats and copy number variations implicated in Hutington’s disease aren’t the result of Homologous Recombination and Unequal Crossover. Is that right? Colewd and Mung might be interested to hear your concession.

    What fucking concession? I told you yesterday, that Huntington’s disease was due to slippage, that it wasn’t like the repeats involving long sequence “units.” That was long before you mentioned Huntington’s disease! Huntington’s involves a repeat where the unit is one codon Sal. One fucking codon! That’s three nucleotides (of course you don’t know this, you probably think that CAG is an acronym, or the name of a DNA region, like D4Z4).

    As I said, you’re a lost cause. I have given you the link three times already, but you cannot be bothered to click on it.

    P.S. If you click on the link, please make sure to read all the way , including the last paragraph. It’s not that long of a comment, so I doubt it will hurt your eyes.

  27. So. Back to the nested hierarchy. However briefly.

    If we don’t know the cause of the apomorphies which define the clades then we do not have a causal explanation for the clades. It follows that we don’t have a causal explanation of the nested hierarchy.

    So what kind of explanation do we have absent a causal explanation? At least Darwin attempted to provide a causal explanation.

  28. Corneel,

    Thanks for the response. So the preference might not be due to Unequal Crossover homologous recombination but rather to natural selection in that theory.

    So copy PREFERENCE of sp100-rs is not due to Unequal Crossover homologous recombination. Even assuming unequal crossover was the duplication mechanism, it’s not the mechanism that creates and maintains preferential copying. Which to me highlights why Dr. Entropy was wrong.

    That said. Back to the point about Unequal Crossover Homolgous recombination causing loss of DNA ….. In a diploid species, if copy number were altered in a haploid in the meoisis process, half the time this will lead to increase of the repeat by one unit, and half the time a loss by a unit in the offspring. Is that right? There is no guarantee it will be an increase in duplication, it could just as well be a loss. A flip of a coin if you will.

    So if Unequal Crossover homologous recombination were going on with other genes, that could lead to gene or repeat loss too in each individual right?

  29. stcordova: So explain to colewd why you think sp100-rs has 2000 more repeats than another gene.

    Asked and answered for the general case. Just look upthread.
    Regarding sp100-rs specifically, its function is not known, but it is one of the most transcriptionally upregulated genes in old adipose tissue (Starr 2015, PMC3633415), so according to Sal it is functional.
    Perhaps this function benefits from extremely high copy number. In older mice.
    ETA: Or segregation distortion, apparently. Yikes, maybe Dawkins was right about selfish DNA. Thanks for the heads-up, I’ll remember to give a shout-out to Sal anytime I use this example.
    🙂

  30. stcordova,

    I wasn’t wrong. I explained the mechanism for the multiplication of repeats, which is what you asked. We also answered why some regions and not others for the general case. You’re an authentic, shameless, ass-hole.

    This is going to guano, but you’ll still be an authentic, shameless, ass-hole.

  31. We’ve also already explained to Sal that cross-over creates and removes repeats indiscriminately, but selection decides who gets to stay.
    Now he’s just blithering.
    Quelle surprise.

  32. Mung:
    If we don’t know the cause of the apomorphies which define the clades then we do not have a causal explanation for the clades. It follows that we don’t have a causal explanation of the nested hierarchy.

    So what kind of explanation do we have absent a causal explanation? At least Darwin attempted to provide a causal explanation.

    No, it doesn’t follow at all. If we don’t have a causal explanation for the limestone that makes up the pyramid, we don’t have a causal explanation for the pyramid, right? But you don’t really believe that. Darwin’s causal explanation for nested hierarchy was common descent. His causal explanation for adaptation was natural selection. He didn’t have a causal explanation for what we today would call mutation. And all these things are different and demand different explanations.

    Incidentally, apomorphies don’t define clades; they diagnose clades, which is not the same thing.

  33. DNA_Jock: We’ve also already explained to Sal that cross-over creates and removes repeats indiscriminately, but selection decides who gets to stay.

    Yep. I do note that natural selection gets accepted a lot easier here then in any of the other active threads. Funny that.

  34. Corneel: I do note that natural selection gets accepted a lot easier here then in any of the other active threads.

    I accept natural selection, I just say that it’s probabilistic. Which seems to lead to paroxysms in others. Funny that. 🙂

  35. So on the topic of whole genome comparisons vs. isolated genes trees:

    http://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.0030181

    Phylogenetic analyses confirm that human and chimpanzee HOR alpha-satellites share a common origin [23] that is evolutionarily distinct from the flanking peripheral monomeric sequences. Every major human alpha-satellite suprachromosomal family shares homologous sequences with chimpanzee (Figures 6A and S5), despite the fact that they map to nonorthologous chromosomes between the two species (Table 3).

    YIKES!

    So we have all these chromosomes that are supposedly homologous. OK, but the centromeric tandem alpha-satelite sequences map differently between the chromosomes. Seems kind of miraculous to me. I would think common descent would predict corresponding chromosomes between humans and chimps would have the the same corresponding alpha satelites, not re-mapped ones! What kind of mutational mechanism would do that?

    The paper didn’t seem like wanted to show the interesting stuff (you know avoid the appearance of POOF-omorphies). They could have provided a detailed table of how the satelite repeats miraculously got remapped between chromosomes. But they didn’t. Bummer.

    And I thought chromosome 2 fusions was amazing, this one takes the cake.

    Well, I’ll still put humans with the chimps in our tree-rebuilding project. Better us beside chimps than lungfish, but that blurb was about the only interesting thing in the paper.

  36. John Harshman: Incidentally, apomorphies don’t define clades; they diagnose clades, which is not the same thing.

    An unnecessary nitpick. I could cite numerous sources that basically say the same thing that I did.

    Can you have a clade with only one taxon and what would it be that defines that clade, the synapomorphies?

  37. The question about the repeats is here.

    Common Design vs. Common Descent

    How are the boundaries of the repeats so exquisitely defined through replication? I actually don’t know what the prevailing mechanistic explanation is.

    To elaborate the problem which sailed over Dr. Entropy’s head I will represent the 3kb D4Z4 repeat as “D4Z4”

    So here are two homologous sequences aligned together

    1. actgactgactgD4Z4actgactgactg
    2. actgactgactgD4Z4actgactgactg

    So an unequal crossover happens. No problem.

    1. actgactgactgD4Z4D4Z4actgactgactg
    2. actgactgactgactgactgactg

    Darwinian selection comes along and wipes out the shorter sequence. Bwahaha! Hmm, makes me wonder there isn’t greater variance between individuals in a population for such repeats, but I digress….

    So let’s say the next round is like this

    1. actgactgactgD4Z4D4Z4actgactgactg
    2. actgactgactgD4Z4D4Z4actgactgactg

    or better, after some mutation like this

    1. yyyyyyyyactgD4Z4D4Z4actgyyyyyyyy
    1. xxxxxxxxactgD4Z4D4Z4actgxxxxxxxx

    So homologus recombination unequal comes along, but then chooses different points to duplicate.

    1. yyyyactgD4Z4D4Z4actgactgD4Z4D4Z4actgyyyy
    2. xxxxxxxx

    Oops. Not exactly what was needed to get

    D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4

    Dr. Entropy kept wailing away at homologous recombination but failed to explain the preferential selection of D4Z4 or sp100-rs, etc. I pointed to him the problem of the randomly selected duplications of the next supposed round of unequal crossover. Unless it the the unequal crossover specifically involves the entirety of D4Z4 (no more no less), one could have a mess.

    I saw that problem, tried to explain, politely told him to buzz off since I didn’t want a confrontation given he had no clue, but he pressed the issue. So he paid the price. He was shown that he couldn’t account for preferential selection of sequences to create multicopy tandem repeats like D4Z4 or alpha satelites or the 2000 copies of sp100-rs in mice.

    Oh well, he missed his chance to learn something.

  38. John Harshman: Incidentally, apomorphies don’t define clades; they diagnose clades, which is not the same thing.

    ok, thanks. Out of deference, because I am sure you are far more qualified than I when it comes to phylogenetics. But you don’t say what does define a clade. Please don’t say synapomorphies. 🙂

  39. But supposing not all copies are wipe out in the population. You could have situation like:

    So let’s say the next round is like this

    1. actgactgactgD4Z4D4Z4actgactgactg
    2. actgactgactgD4Z4actgactgactg

    But the problem is the homologous sections could be define as:

    1. D4Z4actgactgactg
    2. D4Z4actgactgactg

    I’ll bold them and add an elipsis for whatever follows

    1. actgactgactgD4Z4D4Z4actgactgactg….
    2. actgactgactgD4Z4actgactgactg…

    Ok, so another round of Unequal Crossover happens:

    1. actgactgactgD4Z4D4Z4actgactgactgD4Z4actgactgactg….
    2. actgactgactg…

    Well, not exactly the desired result either of:

    D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4D4Z4….

  40. John Harshman:

    John Harshman: Incidentally, apomorphies don’t define clades; they diagnose clades, which is not the same thing.

    Thanks, John.

  41. stcordova: Dispersed repeats like transposons have a mechanism to explain them. Short micro satellite repeat (a few nucleotides) seem to have a good biochemical explanation. But what about long tandem repeats like D4Z4 in the dystrophin gene? That repeat is over 3 kilobases. It don’t believe it is a transposon. 100 such tandem repeats are normal for a healthy human, less than 11 D4Z4 repeats creates muscular dystrophy. How are the boundaries of the repeats so exquisitely defined through replication? I actually don’t know what the prevailing mechanistic explanation is.

    Oh, so you were talking about tandem repeats where each “unit” can be 3000 bases long? You asked about the prevailing mechanistic explanation?

    Who knew? With all your mistaking long tandem repeats with tandem repeats of small “units” like that codon in Huntington’s disease.

    I gave you an answer. Oh, you think that I didn’t also explain the “boundaries of the repeats so exquisitely defined“? Well, I did. I assumed that you understood what complementarity and recombination meant, which would have immediately and automatically answered that part of the question too. For good measure, I insisted further about that. However, that still assumed that you understood some basic genetics and DNA structure. But you have no damn idea do you?

    stcordova: … but failed to explain the preferential selection of D4Z4 or sp100-rs, etc

    But that wasn’t part of your original question Salvador. Check it out. We still answered that too, but that wasn’t part of the original question.

  42. stcordova,

    Holy shit, did you not try the text example that I gave you, with the 313 character repeat leading to a 1692 character duplication?
    Here’s what it looks like (this is High School biology, Sal)
    Start with homologous copies of
    aluGENEalu

    and line them up like this
    aluGENEalu
                   aluGENEalu
    cross-over leads to
    aluGENEaluGENEalu
    and
    alu
    the latter will die, iff the intervening GENE was important
    Now that we have
    aluGENEaluGENEalu
    the alus can degrade as much as you like,
    producing
    abcGENEdefGENExyz

    now line up
    abcGENEdefGENExyz
                    abcGENEdefGENExyz
    cross-over leads to
    abcGENEdefGENEdefGENExyz
    and
    abcGENExyz
    Repeat ad nauseam
    There is, at no stage during this process, any requirement to identify any end of any repeat.

    Ack!

  43. John Harshman: If we don’t have a causal explanation for the limestone that makes up the pyramid, we don’t have a causal explanation for the pyramid, right? But you don’t really believe that. Darwin’s causal explanation for nested hierarchy was common descent. His causal explanation for adaptation was natural selection. He didn’t have a causal explanation for what we today would call mutation. And all these things are different and demand different explanations.

    I don’t see the pyramid case as analogous, but we’re not trying to explain the limestone, we’re trying to explain the Great Pyramid. Whatever explanation we choose, shouldn’t it explain the Great Pyramid by reference to physical/mechanistic causes? If your explanation for the Great Pyramid is not one that gives a causal explanation, what kind of explanation is it?

    Are you saying that for the nested hierarchy we don’t need a causal explanation?

    Darwin’s causal explanation for nested hierarchy was common descent.

    Don’t just assert it, show it. But now you are saying that the nested hierarchy does require a causal explanation. Right?

    And all these things are different and demand different explanations.

    Causal explanations? Because you still haven’t answered what the alternative is.

  44. stcordova: Thanks, John.

    Perhaps it is synapomorphies which define clades. And what is a synapomorphy? A shared apomorphy.

    An apomorphy is a character that is different from the form found in an ancestor, i.e., an innovation, that sets the clade apart (“apo”) from other clades. A synapomorphy is a shared (“syn”) apomorphy that distinguishes a clade from other organisms.

    https://en.wikipedia.org/wiki/Synapomorphy

  45. Mung: An unnecessary nitpick. I could cite numerous sources that basically say the same thing that I did.

    Can you have a clade with only one taxon and what would it be that defines that clade, the synapomorphies?

    Either your sources are wrong or you misunderstand them. I don’t know what “a clade with only one taxon” means, but what defines a clade is monophyly. There are several different sorts of taxon definitions in use these days, and they’re all based on identifying some particular node or branch on a tree. Even so-called apomorphy-based or character-based definitions are about tree topology, not the characters themselves.

Leave a Reply