Aurelio Smith’s comments vanish from UD

Posted on by

Petrushka writes:

There’s a rumor that all of aurelio smith’s posts at UD have disappeared. Big win for Winston Ewert.

I looked, and sure enough, Smith’s comments are all gone — even from his guest thread.

UD has sunk to a new low.

112 thoughts on “Aurelio Smith’s comments vanish from UD”

  1. A bloke annoys you by being too clever by half and talking back to you, so you want to teach him a lesson by kicking him unconscious. But you’ve had too little practice, because you kick people unconscious only once a week, so you accidentally overdo the kicking, and the fellow dies, entirely by accident. So it goes. Just keep quiet about it. Apologies won’t bring him back to life anyway.

  3. Mark Frank:

    I think this must be an accident – may be an unanticipated by-product of banning him. It is too obvious and pointless to simply delete all his comments.

    To a level-headed person, yes. But Barry often acts impulsively, only to regret it later.

    Case in point: deleting an entire thread that made him look like an idiot.

    I expect he’ll handle the Aurelio Smith incident the way he handled that one: say nothing at all and wait for it to blow over.

  6. I think it is quite possible that Aurelio’s complete obliteration could have been an accident. And if it had happened on other sites (TSZ included) I would be willing to accept that as an explanation. But given Barry’s past examples of reprehensible behaviour and outright dishonesty, I am less charitable towards him.

    Regardless, it is a moot point. If Barry admitted that he made a mistake and accidentally erased Aurelio’s existence I might reluctantly take him at his word. But one of Barry’s many less endearing qualities is his pathological inability to admit a mistake. When obvious errors are brought to his attention, his immediate response is to resort to name calling followed by a banning. Not exactly the actions of a mature adult.

  7. Most forum software doesn’t have a delete member button. You have to use database utilities. I suspect Barry did this at the request of DEM. If not, we will see an offer from Ewert to continue the debate some we. That’s the diagnostic.

  8. UD uses WordPress. Anyone see a delete user button you can click by mistake?

  9. petrushka:

    I suspect Barry did this at the request of DEM. If not, we will see an offer from Ewert to continue the debate some we. That’s the diagnostic.

    Perhaps someone still allowed to post at UD could invite Ewert to continue the conversation here. I, for one, would be interested.

  10. Patrick:
    petrushka:

    Perhaps someone still allowed to post at UD could invite Ewert to continue the conversation here.I, for one, would be interested.

    It turns out that Dr. Ewert has posted at UD (Ask Dr. Ewert) that links to a blog where he will respond to questions.

    Ask Dr. Ewert

    But still not a peep from anyone at UD acknowledging that the purge even took place.

  12. Acartia: It turns out that Dr. Ewert has posted at UD (Ask Dr. Ewert) that links to a blog where he will respond to questions.

    http://www.uncommondescent.com/intelligent-design/ask-dr-ewert/

    But still not a peep from anyone at UD acknowledging that the purge even took place.

    But not enter into dialogue, I don’t think. He will answer questions that get voted up. But there needs to be some back and forth for it to be a discussion.

    He did post here once. I hope he will again.

  13. Elizabeth: But not enter into dialogue, I don’t think.He will answer questions that get voted up.But there needs to be some back and forth for it to be a discussion.

    He did post here once.I hope he will again.

    Agreed.

  14. I happened to have the “Signal to Noise” discussion open in a browser tab, so I was able to record Aurelio’s comments from that thread at least. For the record, here they are (33 in total):

    (Originally #56) Aurelio Smith April 24, 2015 at 10:18 am

    Oh dear!
    My first chance to comment and I see the thread is already being derailed.
    I will try and respond to comments over the weekend. Thanks again to johnnyb for hosting the post and may I echo KF in comment 11 in appreciating the largely equable tone so far.

    (Originally #65) Aurelio Smith April 24, 2015 at 11:02 am

    Elizabeth Liddle asks:

    Do you agree that if they want to make the argument that this implies a Designer, they need to make the argument that it is somehow improbable that an environment would have the properties required to generate a solution to the problem of breeding in it?

    Yes, absolutely. As I said in the OP “If anything is designing, it is the environment”.

    (Originally #113) Aurelio Smith April 25, 2015 at 12:37 am

    johnnyb writes

    Many apologies for not joining in the fray. My schedule is a bit packed at the moment, but I hope to come back to here soon.

    No problem, Jon. Some of us have real lives to lead and must fit our internet activity into the space available.
    Mung:

    Aurelio Smith has had no response. You’ve missed nothing.

    Seems to me Aurelio Smith has had 112 resposes so far, though Aurelio Smith does not consider them all to be substantive.
    Aurelio Smith will attempt to find time over the next day or two to pick up on substantive points raised in comments so far.

    (Originally #114) Aurelio Smith April 25, 2015 at 12:57 am

    Jon Garvey writes:

    But a “kaleidoscope of constant change” is at least as random as mutations are supposed to be. If it is true, what factor in the theory of evolution can possibly give it the prolonged trajectories we see – which alone enable it to be represented as a tree?

    One might say that aspects of environmental change are unpredictable. Some might say that God moves in mysterious ways. Once you have your population of replicating organisms, where the replication is not perfect, the non-random process of selection can sieve out the better exploiters of that environment.
    Your question assumes that this process is teleological. Playing Devil’s advocate, I suggest that God can design us by designing the environment (with it’s kaleidoscope of constant change) to produce us (along with our parasites and every other organism).
    But the question that interests me is whether DEM have, in proposing their concept of “active information”, produced or argued against a model that accurately represents what is proposed by the current theory of evolution.

    (Originally #115) Aurelio Smith April 25, 2015 at 1:01 am

    SimonLeberge writes:

    I’m particularly interested in how specified complexity and active information “live together” in ID theory.

    There seems to have been a change in emphasis since Dr Dembski began his collaboration with Dr Marks. CSI seems to have gone the same way as the explanatory filter.

    (Originally #116) Aurelio Smith April 25, 2015 at 1:06 am

    SimonLeberge writes;

    As Mark Frank has indicated, the active information is

    log(q/p) = log q – log p,

    where p is the probability that a “totally random” guess generates the target event, and q is the probability that the “search” (selection process) generates the target event. (However, Mark contends that “totally random” is not well defined.) The more formally you can express the relation of this measure to FSCO/I, the better for me.

    Am I right in understanding that “p” is needle and”q” is haystack?

    (Originally #117) Aurelio Smith April 25, 2015 at 1:18 am

    Mark Frank writes:

    All evolution does is evolve organisms to a state where they are sufficiently fit to survive.

    I don’t think this is correct. Organisms live in the moment and to contribute their alleles to at least the next generation they already need to be fit enough to survive in their niche. They get on with living. Organisms are fixed, with regard to the genetic information they contain. the change that occurs over time is allele frequency. Populations change over time due to the survival or loss of alleles in populations of organisms.

    I think this is a key misunderstanding because artificial simulations are sometimes accused of sneaking in the information about the target via the fitness function. But actually by creating a fitness function they are creating a target.

    indeed. It is a key misunderstanding to attempt to evolutionary processes as a search. Variation gets into the gene pool and either makes it into succeeding generations or doesn’t.

    (Originally #118) Aurelio Smith April 25, 2015 at 1:26 am

    Elizabeth Liddle writes:

    …the only kind of “evolutionary” process that would be no better than random search would not be like any “evolutionary process” that actually exists. We’d have to postulate offspring were similar to their parents in no respect that affected their capacity to breed. So that would mean that either they were really really unlike their parents (in which case we wouldn’t call them “self-replicators”) or that their similarities were completely orthogonal to their capacity to breed.

    Exactly. The key postulate of evolution is that survival (at least to the point of being able to breed) is the selecting agent for the alleles that survive through generations.

    Which may be of mathematical interest, but seems irrelevant, unless someone is postulating that a designer is needed to ensure that two breeders with similar properties should often include properties that affect their ability to breed.

    It is possible that DEM’s work has other applications and applications.

    (Originally #)120
    Aurelio Smith April 25, 2015 at 1:33 am

    Don Pedro/Piotr writes:

    The environment doesn’t act on the genome directly. It only “informs” the genetic pool which alleles survive better (because the phenotypes they produce have some advantageous traits). A DNA sequence responsible for those traits does not even look “designed” by itself. Is this one designed or random, and how do you know?

    ACATCCACACTTTGGTGAATCGAAGCGCGGCATCAGGGTTTCCTTTTGGATACCTGATAC

    Excellent point. When ID methods can find the signal in the noise, it will be a momentous achievement. That day is not here yet.
    ETA All I have time for till later

    (Originally #244) Aurelio Smith April 25, 2015 at 2:05 pm

    Jon Bartlett writes

    …a list of points that I thought that Aurelio faulted upon:

    1) the list of “crazy searches” is actually needed biologically, precisely because making true jumps in fitness requires surprising sets of mutations. Gregory Chaitin found this out in his modeling of evolution in Proving Darwin – every attempt using incremental search techniques landed him very quickly on, I forget the term, but minor peaks towards the beginning of the search, and not actually making any progress. For him to actually get novelty that wasn’t precoded, he had to introduce macromutations.

    2) The article says, “the laws of physics will mandate that small changes in genotype will usually not cause huge changes in fitness.”. The problem is in the cases where recursivity is required. Here you run into the problem that Chaitin did – in order to hit the next peak, you need crazy macromutations, because the in-betweeners aren’t selectable.

    I’ll treat this as one point as I think it is essentially the same point. DEM do not mention needing “surprising sets of mutations” to get “true jumps in fitness” or to get “recursivity”. In fact I”m not sure what you mean by it in the context. (I doubt your are referring to Professor Shallit’s blog). Also “macromutation” sounds suspiciously like “saltation” and Goldschmidt’s hopeful monsters. You also seem to be sucked by the metaphor of the fitness peak. The evolutionary landscape changes and populations of organisms can stumble over saddles and bridges that form and fade.

    3) English’s summary statement – “we see that Dembski, Ewert, and Marks’s argument does not show that Design is needed to have an evolutionary system that can improve fitness.” I think would be agreed to by all parties. The question is not whether improved fitness can happen, but how much and how far. That is where such reasoning falls down. That is why Dembski often uses 500 bits as the mark (it is based on the Universal Probability Bound). It’s not that *any* evolution needs to be shown, but rather 500 bits of evolution is shown (I would personally be happy with, say, 100 bits).

    I see Elizabeth Liddle and SimonLeberge have both addressed this. Why should some arbitrary limit be pulled from thin air?

    4) One of the article’s main points is whether or not evolution is actually a search, on the basis that evolution is passive, not active.

    This is a personal foible of mine. In considering evolutionary processes, some issues are clearer when looking at simpler examples. Plants are hugely important in the biosphere. No plants means no animals including us. The ways in which (the vast majority of land-)plants exploit their environment cannot be done by thinking (no nervous system) or moving (no musculature etc) yet clear a patch of ground and wait. Are plants actively exploiting the opportunity?

    However, this has several issues:

    (a) the article conflate “search” with “optimal solution search”, or at least you appear to. An optimal solution search is not required for the formalism. It is often used because it is more recognizable and understandable both for the investigator and for the audience.

    I’ve said evolutionary processes are not searches.

    (b) even if organisms are passive, it doesn’t make it not a search from the mathematical formalism. Now, if the author thinks a better mathematical formalism would work, what is it? If there isn’t one, that seems bad for evolutionary theory as a scientific concept.

    That’s a default argument along the lines of “if we can’t think of an answer we should stop looking.”

    c) As to organisms being passive in evolution, the evidence is that they aren’t. The idea of passive organisms is a leftover from a generation of biologists raised on Dawkins, which modern biologists are working hard to correct. See for instance Denis Noble’s speech to the American Physiological Society.

    Yes well Denis Noble is currently promoting a third way. Glancing through Elizabeth Liddle’s blog, I see she considers Noble to be on to something. I’m not so sure. Not dismissive, just not so sure.

    (Originally #245) Aurelio Smith April 25, 2015 at 2:15 pm

    JohnnyB and Aurelio Smith, I apologize for temporarily derailing this thread.

    Not to worry. It’s not as if you were the prime instigator.

    (Originally #250) Aurelio Smith April 25, 2015 at 2:30 pm

    @ KF
    I consider your comments no’s 5, 19, 21, 35, 39, 82, 85, 92, 126, 129, 138, 141, 142, 145, 146, 147, 152, 172, 184, 189, 196, 201, 207, 211 as unresponsive to the OP so I won’t be responding to them.
    92, 126 and 129 especially make me inclined to back away slowly.
    Surely you could address these matters of persecution and paranoia in another thread.

    (Originally #251) Aurelio Smith April 25, 2015 at 2:32 pm

    @ Barry Arrington
    Who is Thomas Nagel and what does he say about active information? Does he use the same definition as DEM?

    (Originally #255) Aurelio Smith April 25, 2015 at 2:46 pm

    @ KF
    Include comment 246 in the list of comments that will not be responded to by Aurelio Smith.
    I’m getting a little concerned for you. I control my internet addiction by an oven timer and walks in the countryside.
    Or you could find more time for fishing.

    (Originally #257) Aurelio Smith April 25, 2015 at 3:03 pm

    mung writes:

    But Active Information is intimately related to searches.

    That hasn’t been established so far in this thread or elsewhere as far as I am aware. Could you (or anyone) elaborate?

    (Originally #259) Aurelio Smith April 25, 2015 at 3:29 pm

    mung writes:

    It’s right there in the OP. The section titled Active Information.

    That’s elaborating?
    Let’s have a five-minute argument. No it isn’t.

    (Originally #261) Aurelio Smith April 25, 2015 at 3:46 pm

    Barry Arrington writes (to Elizabeth Liddle):

    Who knew you were an Aristotelian? You are saying that the actuality “water” has the potency “white” under certain conditions. Careful; it is not that far from Aristotle to belief in God. The very dichotomy to which you indirectly allude (act; potency) leads inexorably in that direction.

    As one can hardly complain to the blog owner about derailing threads on his own blog, let me just observe that I find it a little ironic how Ed Feser distances himself from “Intelligent Design”. If ever there was a natural ally…

    (Originally #301) Aurelio Smith April 26, 2015 at 1:36 am

    Mung ask:

    Shouldn’t you know the definition of active information as given by DEM before asking such a question?

    From my OP quoting DEM:

    We therefore define the endogenous information I? as –log(p), which measures the inherent difficulty of a blind or null search in exploring the underlying search space ? to locate the target T. We then define the exogenous information IS as –log(q), which measures the difficulty of the alternative search S in locating the target T. And finally, we define the active information I+ as the difference between the endogenous and exogenous information: I+ = I? – IS = log(q/p). Active information therefore measures the information that must be added (hence the plus sign in I+) on top of a null search to raise an alternative search’s probability of success by a factor of q/p.

    I asked who is Thomas Nagel (I assume you are referring to the lawyer/philosopher) and what he has to say about “active information”. My research turns up absolutely nothing. So I’m puzzled why anyone is referring to Nagel in a thread about “active information”.

    (Originally #309) Aurelio Smith April 26, 2015 at 7:11 am

    KF writes:

    (And BTW, dealing with actual defamation and stalking, coming from your side and from agitators/activists cossetted by TSZ as a genteel front group, is not paranoia. Given the known Bill Clinton 1-2 punch tactic, the timing and focus of this thread are not something I can take as coincidental given actual implicit threats along the lines of we know you, where you are, those you care for to remote degrees and we are there on the ground scouting/stalking. And more. So, kindly put away your dismissive tagging.)

    What has this to do with the topic of this thread? You are projecting, Sir. Is it your intention to drown this thread with off-topic waffle?

    (Originally #312) Aurelio Smith April 26, 2015 at 7:21 am

    KF writes:

    PS: AS, lay off the snide insinuations, it is obvious that you do not understand and probably don’t care to understand what it is like to be subjected to years of hate driven cyber stalking and slander backed up by what now looks very likely to be escalation to on the ground stalking [based on trumpeting information that simply is not accessible online and would require local knowledge, of course twisting it into utter false accusations on abusing a business premises to consort with criminals . . . which as I have pointed out potentially harms a rehabilitated murderer who is on lifelong parole after 25 years in gaol and whose rehabilitation I support along with other people], which takes things to an utterly new level.

    More projection. You are right about not caring. Please take your complaints to the appropriate authority or to somebody that doesn’t think this is all paranoia. At least start your own thread so that those that wish to discuss your paranoia can do so without being interrupted by comments about “active information”.

    (Originally #352) Aurelio Smith April 26, 2015 at 12:12 pm

    Elizabeth Liddle writes:

    I am entirely in agreement with you that consciousness exists. So do the vast majority of people working in the field (I don’t actually know of anyone who denies it).

    Michael Graziano has expressed some doubt.

    (Originally #370) Aurelio Smith April 26, 2015 at 1:30 pm

    mung writes:

    daveS,

    I think you should shut up unless you’ve walked in his shoes.

    It might help if Kairosfocus either shut up or clarified his innuendos against Elzabeth Liddle and, I think, me, as far as it is possible to tell from his unparagraphed rants. He is smearing Ms Liddle without the least pretext. Whether it is a ploy because he is embarrassed at being unable to address the topic of the post I don’t know. What this says for apparently influencial contributors to this blog I don’t need to point out. The blog owner is apparently comfortable to let this continue. Fair enough. That it reflects badly on the whole movement is not my business so carry on.

    (Originally #374) Aurelio Smith April 26, 2015 at 2:19 pm

    Mung
    Can I ask, if you think evolutionary processes are a search, who is doing the looking and what are they searching for?

    (Originally #413) Aurelio Smith April 27, 2015 at 1:40 am

    I don’t know how Jon Bartlett feels about how the comments thread has developed from his kind offer to host an OP on “active information”. I am rather disappointed. I wonder, do any ID proponents who haven’t yet said anything share my view?

    (Originally #456) Aurelio Smith April 27, 2015 at 2:44 pm

    @ truthbringer
    Please stop. There is a worrying similarity between your latest comments and those you are attacking.

    (Originally #457) Aurelio Smith April 27, 2015 at 2:48 pm

    Upright Biped says:

    I’ve merely watched and … and … kept my mouth shut.

    You’re not the only one. Jon Bartlett has been the only ID proponent so far making an attempt to address the OP, notwithstanding the late flurry by mung. I was hoping for a little more interest in a supposedly key component in ID thinking.

    (Originally #459) Aurelio Smith April 27, 2015 at 2:58 pm

    To the mods, assuming anyone tends to housekeeping here,
    This thread is becoming impossibly slow to load for me due to having to post via a VPN. I have asked before if someone could remove the block on my home IP address.
    Anyway I’ll try to respond here to mung’s points until the page freezes indefinitely.

    (Originally #464) Aurelio Smith April 27, 2015 at 3:28 pm

    Elizabeth Liddle started an OP at her own blog and I see Professor Joe Felsenstein has responded to Jon Bartlett’s comment

    I tried posting it here as I know most people here aren’t keen on following links but the attempt timed out. Anyway, here is the link. I’ll email Jon Bartlett to see if there can be a follow-up thread (Barry willing) as It is impossible for me to post a comment of any length now.

    (Originally #465) Aurelio Smith April 27, 2015 at 3:38 pm

    In conclusion, I’ll just remind anyone still reading of what I said in the OP:
    The search for a solution to a problem is not a model of biological evolution and the concept of “active information” makes no sense in a biological context. Individual organisms or populations are not searching for optimal solutions to the task of survival. Organisms are passive in the process, merely affording themselves of the opportunity that existing and new niche environments provide. If anything is designing, it is the environment. I could suggest an anthropomorphism: the environment and its effects on the change in allele frequency are “a voice in the sky” whispering “warmer” or “colder”. There is the source of the active information.
    Active information is no more useful at establishing “design” from “non-design” than the “explanatory filter” of yore and the concept of CSI. ID has not shown us how to separate the signal from the noise.

    (Originally #540) Aurelio Smith April 29, 2015 at 10:18 am

    Winston Ewert has responded to the post at Pandas Thumb by Felsenstein and English. Perhaps Jon Bartlett or someone else who can start OPs here would like to create an opportunity to comment on it.

    (Originally #560) Aurelio Smith April 29, 2015 at 3:55 pm

    Winston Ewert at EN&V

    One might ask, why birds? Birds are, in this discussion, thus far the target. By “target,” we do not mean something for which the search is actively looking. Recall that the only requirement of the search is that it be representable as a probability distribution. The target plays no role in what constitutes a search; rather, the target only features in the context of measuring the active information in a search. The target is effectively the measuring stick. The choice of target is arbitrary, and I could have as easily chosen cities, paintings, beetles, cows, volcanoes, mountains, lakes, or crystals. The same conclusion applies to all of them: they show up far more often than chance would lead us to expect. Within a materialist framework, they have to be explained by a process biased in favour of producing them.

    Remember, we began by noting that birds are rather improbable configurations of matter. Advocates of Darwinian theory postulate unguided evolution as a search process to account for this improbable configuration. What about the configuration of the process itself? While some processes are biased towards birds, many others are biased towards other configurations of matter. In fact, a configuration biased towards producing birds is at least as improbable as birds themselves, possibly more so.

    Wow! Talk about missing targets! How on Earth did ;insects find out how to fly? How did pterosaurs learn to fly? How did bats learn to fly? Design, of course! There can be no other explanation. So it has to be design.

    (Originally #566) Aurelio Smith April 29, 2015 at 4:41 pm

    mung writes:

    Aurelio Smith asserted that there were no targets in evolutionary processes and asked me to provide evidence to the contrary. I offered the immune system.

    That’s a very interesting subject and I’d love to explore it in detail together with you. You’re wrong to think that the immune system is “targeted”.

    I’m still waiting for a response Aurelio.

    Ask the powers-that-be to unblock my home IP. A short comment appears eventually. A long comment just hangs. We could move discussion elsewhere, if you’re really interested in communication.

    (Originally #567) Aurelio Smith April 29, 2015 at 4:44 pm

    mung claims:

    Aurelio is trolling,

    Oh, the irony!

  15. Reciprocating Bill posted the following on Barry’s new thread. I hope he and others will keep the pressure on Barry.

    Barry:

    Do we get to know what happened to Aurelio Smith? He and all of his posts have disappeared from the entire site, as I’m sure you’re aware.

    Lots of speculation. Many think it was some sort of accidental deletion, unintended consequence of a banning, or something similar. Others find that inference to the best explanation points another direction.

    Why not clarify?

  16. Gordon Davisson: mung writes:

    daveS,

    I think you should shut up unless you’ve walked in his shoes.

    Worth remembering the next time Mung opines on others.

  18. I asked Barry at his hilariously funny thread “Sunday Fun“

    à propos “oops”: Barry, what happened to the comments of Aurelio Smith? Could those be restored, please?

    The comment appeared for a short time, I tried again, also with little luck, and after a third trial, it seems that I’m banned from Uncommon Descent (after seven years of contributing…)

    The cover-up is always worse than the crime…

  20. Lizzie maintains the pressure:

    And frankly, Barry, I see no reason why anyone should spend any length on composing responses to anything on this site, given the apparent risk that they will be deleted in their entirety without explanation.

    If anything is “ad hominem” it is your use of the “delete user” button on WordPress.

    If you want to know what I think about Meyer’s book, come to TSZ, where nothing will be deleted except for porn, malware and personal details, and no-one is banned for anything except posting those things.

  21. As does eigenstate:

    Also, will someone comment on the disappearance of all of Aurelio Smith’s posts? I guess I can conceive of some highly unusual accident resulting in the deletion of his user account and therefore all of his posts. But given the empirical evidence gathered over several years on this blog, it’s impossible to avoid the suspicion that this is yet another case of administrative abuse on this forum. If it was an accident, I guess I’d expect there to be some acknowledgment of that.

  22. Barry has honesty and disclosure issues. I thought he had “higher standards” and “objective morality”?

  23. Acartia: It turns out that Dr. Ewert has posted at UD (Ask Dr. Ewert) that links to a blog where he will respond to questions.

    I’ve added three straight-up technical questions to the two that DiEb posted at Ask Dr Ewert. I doubt that Winston is particularly keen on addressing any of them. Please vote us up.

    DiEb also asked what happened to an erratum regarding the botched Horizontal No Free Lunch Theorem. He and I both know that he explained the sophomore-level error to Marks before Dembski and Marks submitted the paper to the journal that published it. I could have asked a similar question: “Why didn’t you take logarithms of quantities in the last two columns of Table III in `Algorithmic Specified Complexity in the Game of Life’?” The apparent answer is that it would have been obvious that claims in the text did not comport with the data. By the way, Ewert and Marks have not responded to email notes I sent them regarding the paper (with no mention of Table III).

    Winston has gone with a format that allows him to claim that he picked the best questions, without having to account for why he ignored the ones that made him uncomfortable. I’d be quite surprised if he accepted Lizzie’s invitation to post at TSZ.

  25. Tom English,

    I’ve added three straight-up technical questions to the two that DiEb posted at Ask Dr Ewert. I doubt that Winston is particularly keen on addressing any of them. Please vote us up.

    I suggest instead that no one participate in Ewert’s attempt to control the dialog by placing himself in a position where everyone else is his supplicant. If he lacks the minimal intellectual courage required to participate in an open discussion, that says a great deal about his confidence in his position.

    Being raised in the kind of fundamentalist environment that results in one becoming an creationist ID proponent certainly explains his authoritarian leanings. I hope that everyone chooses to disabuse him of them.

  26. Tom English,

    I don’t think that is any worse than Lizzie accusing Stephen Meyer of not understand evolutionary theory, and then when asked WHO DOES understand it better (her?) her reply is to simply (ok, not simply, Lizzie is incapable of saying much simply) say: “Evolution is an entire body of consilient sub-theories….”

    Ok, so do you have that strong understanding of it Lizzie????

    Is that any different than Winston refusing to answer you?

  27. its all relative, Phoodoo but her understand is obviously much greater than yours or Meyer’s.

  28. Wow, powerful reply from the atheist pit-bull Richard!

    He strikes again!

  29. Phoodoo, since you’re so hot on defending Meyer’s Cambrian idiocy, please tell us:

    What is the ID explanation for the 100 million years of multi-celled life before the Cambrian period (i.e. Ediacaran biota) and the 2+ billion years of single-celled life before that?

    I’ve asked this question dozens of times to all those defending Darwin’s Doubt and have never received an answer,

  30. Phoodoo, now that you have resurfaced on this thread, are you willing to go out on a limb and say, for the record, whether you think Barry’s erasure of all of a persons comments, and subsequently deleting comments and banning people who mention it, is the behaviour of someone who values open and honest discussion.

    A simple yes or no will suffice.

  31. Acartia,

    If one wants to run a reasonable, honest website, allowing people to just spam it with nonsense is probably not a good strategy. I think when Lizzie makes blind accusations about scholars knowledge in a field, and then runs away from defending that , she is perhaps guilty of simply trolling.

    So, in answer to your question, I don’t believe in the anything goes high school insult hurling philosophies of some websites, such as this one; some moderation is needed.

  32. phoodoo:
    Acartia,

    If one wants to run a reasonable, honest website, allowing people to just spam it with nonsense is probably not a good strategy.I think when Lizzie makes blind accusations about scholars knowledge in a field, and then runs away from defending that , she is perhaps guilty of simply trolling.

    Except Lizzie didn’t do that with Meyer. She laid out the specific reasons Meyer is wrong and supported it with evidence. Meyer’s garbage has been decimated in the actual scientific community and he’s pretty much a laughingstock of actual paleontologists.

    BTW I see you can’t answer my questions on Meyer’s Cambrian claims. Don’t feel bad, every other IDiot has run from them too.

  33. Elizabeth: But not enter into dialogue, I don’t think. He will answer questions that get voted up. But there needs to be some back and forth for it to be a discussion.

    He did post here once. I hope he will again.

    I don’t think I did. As I recall I only ever requested spelling corrections to my name. And don’t get me wrong, I’m not trying to avoid back and forth, which I do think is valuable. I just don’t think that comment threads are a great way to do that.

    Tom English
    Winston has gone with a format that allows him to claim that he picked the best questions, without having to account for why he ignored the ones that made him uncomfortable. I’d be quite surprised if he accepted Lizzie’s invitation to post at TSZ.

    I think it’d be pretty hard for me to ignore some questions with high up-votes just because I didn’t want to answer them without people noticing. It seems to me that I’ve put myself in a position where I have to answer the questions or lose face.

    Patrick:
    I suggest instead that no one participate in Ewert’s attempt to control the dialog by placing himself in a position where everyone else is his supplicant.If he lacks the minimal intellectual courage required to participate in an open discussion, that says a great deal about his confidence in his position.

    I publish papers explaining my arguments. I write blog posts responding to criticisms and attempting to clarify misunderstandings. I sometimes engage in comment threads to address simpler questions people have. Now, because I’ve tried to experiment with another way of allowing people to engage me, you decide to claim that I don’t want to engage in open discussion? That just makes no sense.

  34. winstonewert:

    I publish papers explaining my arguments. I write blog posts responding to criticisms and attempting to clarify misunderstandings. I sometimes engage in comment threads to address simpler questions people have. Now, because I’ve tried to experiment with another way of allowing people to engage me, you decide to claim that I don’t want to engage in open discussion? That just makes no sense.

    What do you know about Aurelio Smith’s banning and the deletion of all his posts at UD? Do you think it was warranted or fair?

    At least one other poster at UD, DiEb, has been banned merely for asking about the Smith deletions. What is your opinion about UD’s actions regarding this case?

  35. Winston Ewert:

    And don’t get me wrong, I’m not trying to avoid back and forth, which I do think is valuable. I just don’t think that comment threads are a great way to do that.

    Comment threads are great for that, because you get both the back and the forth, and the turnaround is quick.

    If you’re confident in your position, why wouldn’t you welcome that?

    P.S. Like Adapa, I’d like to hear your take on Barry’s recent actions toward Aurelio Smith.

    Also, have you seen the following thread? In the comments, we identify more than 20 substantive errors in your recent paper.

    Algorithmic Specified Complexity and the Game of LIfe

  36. Adapa: What do you know about Aurelio Smith’s banning and the deletion of all his posts at UD?Do you think it was warranted or fair?

    At least one other poster at UD, DiEb, has been banned merely for asking about the Smith deletions.What is your opinion about UD’s actions regarding this case?

    I don’t know anything about it. I don’t think I would take the same actions myself, but since I don’t know the reasons behind the actions that were taken, I hesitate to pass judgement.

  37. keiths:
    Also, have you seen the following thread?In the comments, we identify more than 20 substantive errors in your recent paper.

    Algorithmic Specified Complexity and the Game of Life

    Herein lies a big part of why I think comment threads are a bad way to go. Rather then write a blog post where you listed out your issues, you put them as a series of comments where they would under most circumstances have never come to my attention.

  38. winstonewert: I don’t know anything about it. I don’t think I would take the same actions myself, but since I don’t know the reasons behind the actions that were taken, I hesitate to pass judgement.

    You have no opinion when someone you were in the middle of a technical discussion with has all their posts mysteriously deleted? Really?

  39. Winston,

    Herein lies a big part of why I think comment threads are a bad way to go. Rather then write a blog post where you listed out your issues, you put them as a series of comments where they would under most circumstances have never come to my attention.

    That’s a silly objection. That OP is about your paper, and so are my comments. It made perfect sense for me to post them there, and you are free to respond.

    You should pay more attention to TSZ. We often examine the EIL’s work here, and the discussions are quite a bit more substantive than those at UD. Best of all, we don’t censor or ban people (the only person who managed to get himself banned here was — you guessed it — Joe G. And that was for linking to porn.).

  40. winstonewert: don’t think I did. As I recall I only ever requested spelling corrections to my name. And don’t get me wrong, I’m not trying to avoid back and forth, which I do think is valuable. I just don’t think that comment threads are a great way to do that.

    Good to see you here, Winston! And apologies again for misspelling your name last time – I think I’ve finally knocked the correct spelling into my aging brain!

    I do understand why comment threads can be difficult, especially when your position is a minority one in the thread (as it probably would be here). But in my experience, comment threads are a really excellent way to discuss ideas – better even than face-to-face debate, because people have time to reflect and compose their responses. I’ve learned a huge amount from internet discussions.

    So I’d like to reiterate my invitation for you to write an OP here, and, if you do, I think the other moderators and myself would be more than happy to err on the stringent side in our application of TSZ rules, which can be summarised as: “Assume the other poster is posting in good faith”.

    I should just say that, although, technically, WordPress allows you to moderate your own threads (we may be able to get a mod that disables that), we do ask thread-starters not use their editing powers. But you can PM a mod if you want anything looking at. If a comment violates the rules it will be moved to our “Guano” pile (i.e. not deleted, but moved out of the way of the thread).

    Cheers

    Lizzie

  42. Patrick:

    I suggest instead that no one participate in Ewert’s attempt to control the dialog by placing himself in a position where everyone else is his supplicant.If he lacks the minimal intellectual courage required to participate in an open discussion, that says a great deal about his confidence in his position.

    I’ve thought better, and deleted my questions.

    Do I get to ask now why everyone is so hot to dignify Barry Arrington’s faux forum?

    [Edit: Hadn’t seen Winston Ewert’s comments above.]

  43. I will just point out that as Winston is a poster here, and is posting here, the TSZ game rules apply.

    We have no reason to think that Winston deleted Aurelio Smith’s account and post, and to be honest, I have some sympathy with his reservations about posting in a free-for-all forum, which can be a bit like those events were some Grand Master plays 30 chess opponents simultaneously.

    Nonetheless, I do warmly invite him to give it a go. He may be pleasantly surprised.

  46. Elizabeth,

    I agree, and also hope Dr. Ewert participates. Unfortunately the walked garden that is UD is to blame, we are just trying to provide the open forum they should be.

  47. Lizzie,

    When I figure out how to contact him I will ask Paul!

    I left a comment at Paul’s blog earlier tonight letting him know that you’re interested in taking him up on his offer.

  48. phoodoo,

    So, in answer to your question, I don’t believe in the anything goes high school insult hurling philosophies of some websites, such as this one; some moderation is needed.

    So that only the high school insults of one side remain …

  50. winstonewert,

    I’m glad to see you participating here. I hope that you find this open discussion forum as refreshing a change from UD as I do.

    I publish papers explaining my arguments. I write blog posts responding to criticisms and attempting to clarify misunderstandings. I sometimes engage in comment threads to address simpler questions people have. Now, because I’ve tried to experiment with another way of allowing people to engage me, you decide to claim that I don’t want to engage in open discussion? That just makes no sense.

    Attempting to position yourself as an authority who’s time is so valuable that you’ll only deign to answer questions supported by enough supplicants is a pathetic rhetorical device. It strikes me as being modeled on the evangelical preachers I grew up with. That authoritarianism is not conducive to open discussion.

    I hope you choose to participate here. Your ideas will be soundly challenged. If they have merit, they’ll survive. Most people here, myself included, would love to see a testable pro-ID hypothesis. Thus far, no one has presented one. Please be the first.

Leave a Reply