What is the evidence for “purposeful intervention”?

FMM: Purposeful intervention is pretty much the opposite of random mutation.

FMM notes in the same comment:

 If there in nothing about an idea that distinguishes it from it’s alternative it seems to be superfluous.

So the idea is “non designed mutations” and the alternative is “purposeful intervention”.

Give that, and given FMM has not discarded the idea of purposeful intervention there must be something that distinguishes it from non designed mutations.

What is that distinguishing factor? What is the actual evidence for “purposeful intervention” regarding mutations?

And, more broadly, what is the evidence for “purposeful intervention” in any area of biology? Apart from, of course, wishful thinking.

603 thoughts on “What is the evidence for “purposeful intervention”?

  1. fifthmonarchyman:

    GlenDavidson: Design is often characterized by a lack of deliberate patterns, but with a rational fit to a purpose.

    I’ve certainly never heard that characterization.

    You’re supposed to be able to think.

    It would seem to be oxymoronic

    I can’t help your lack of understanding.

    Aren’t “rational” and intentional semanticly related and isn’t a “fit to a purpose” a pattern in itself?

    When you can’t even understand what words mean, no wonder you do so badly with concepts.

    Glen Davidson

  2. GlenDavidson:
    When you can’t even understand what words mean, no wonder you do so badly with concepts.

    Presuppositionalism is a lot about messing up with concepts. You cannot expect much from someone who subscribes to that kind of “thinking.”

  3. Corneel: Sure, but wasn’t the test suppose to demonstrate that people could infer intent from the sequence itself, rather than by association to personally meaningful sequences?

    I don’t think that there is any such thing as an isolated sequence or pattern. There is always context. Sometimes it is known sometimes not.

    Whether or not you infer design is dependent on if you can recognize a pattern that is non-random and non-algorithmic. Whether you recognize it as random often depends on the context.

    Corneel: Unless you expect to feel a great sense of deja-vu when confronted with the DNA sequence of a novel mutation, of course.

    I might or might not feel deja-vu when I see a pattern, if I do I will be more likely to believe that it’s not random. I don’t have to feel deja-vu to infer design. I just have to recognize the pattern as nonrandom and non-algorithmic.

    Corneel: That won’t be necessary; we can work some statistics here. But it should be able to outperform blind guesses.

    I think it does or it would have been eliminated by natural selection long ago.

    Do you think that inferring intent when you see a strange rustle in the bushes that you can’t explain is no better than a random guess?

    peace

  4. newton: How about false positives?

    I think that it’s possible to infer that a strange rustling in the bushes is intentional when it’s really just the wind. That is why I infer design tentatively.

    If I later find an algorithm that can produce a rustling that is indistinguishable from the one I saw I will modify my original inference.

    Notice I don’t withhold judgement and wait till i’m attacked to infer design and I certainly don’t assume no intent until proven otherwise.

    peace

  5. fifthmonarchyman: Designed,Discovered or imagined?

    Kronecker: God gave us the natural numbers. All else is the work of man.

    Personally, I think Kronecker gave God too much credit. But, even leaving that aside, the empty set is not a natural number.

  6. Neil Rickert: But, even leaving that aside, the empty set is not a natural number.

    quote:

    How could we experience the empty set in our lives? An empty meal would not just be a time during the day when you weren’t eating. You would sit down in front of a place setting, no one would bring you food, and then you’d get up and leave. 4’33”, John Cage’s famous empty composition, is not just any 273 seconds of quiet. The performer sits at a piano in front of an audience. The wrapper is important.
    end quote:

    from here

    https://blogs.scientificamerican.com/roots-of-unity/a-few-of-my-favorite-spaces-the-empty-set/

    sounds like a pattern to me. Am I missing something?

    peace

  7. fifthmonarchyman: How would a person go about observing the empty set?

    If you are a mathematical fictionalist (as I am), you don’t even try. If you are a mathematical Platonist — well, you should ask a Platonist about that, since Platonism has never made sense to me.

  8. fifthmonarchyman: An empty meal would not just be a time during the day when you weren’t eating. You would sit down in front of a place setting, no one would bring you food, and then you’d get up and leave. 4’33”, John Cage’s famous empty composition, is not just any 273 seconds of quiet. The performer sits at a piano in front of an audience. The wrapper is important.

    I have never thought of the empty set in any of those ways.

    Mathematics isn’t about reality.

  9. Neil Rickert: Mathematics isn’t about reality.

    OK.

    In that case instead of designing the empty set we can say Mathematicians simply imagined it.

    I haven’t thought much about the “imagination inference” but I see no compelling reason to specify that a distinguishing feature of “imagination” is a non-algorithmic pattern.

    peace

  10. colewd: Would you call it a tool to simulate reality?

    Well, no, I wouldn’t call it that.

    But, sure, it can be used that way. But it can also be used to model things that cannot be found in reality.

  11. fifthmonarchyman: Corneel: Unless you expect to feel a great sense of deja-vu when confronted with the DNA sequence of a novel mutation, of course.

    I might or might not feel deja-vu when I see a pattern, if I do I will be more likely to believe that it’s not random. I don’t have to feel deja-vu to infer design. I just have to recognize the pattern as nonrandom and non-algorithmic.

    That comment was meant to be tongue-in-cheek, but now I get the impression that you seriously expect to recognise novel mutations by some sense of familiarity instilled in you.

    fifthmonarchyman: Do you think that inferring intent when you see a strange rustle in the bushes that you can’t explain is no better than a random guess?

    I think that perceiving a “strange rustle in the bushes” as a possible threat has nothing to do with inferring intent. That is not how it works.

  12. Here is an interesting article that asks if we can build a computer that demonstrates free will.

    https://www.realclearscience.com/articles/2018/03/14/how_to_build_a_computer_with_free_will_110578.html

    I don’t think that the proposed experiment is on the money but it’s a useful first attempt to get at the difference between persons and animatrons.

    Instead of looking for instances when the computer does something “unusual and useless” I would look for a pattern of behavior that not is random and also could not be explained algorithmicly.

    peace

  13. Corneel: I think that perceiving a “strange rustle in the bushes” as a possible threat has nothing to do with inferring intent. That is not how it works.

    Please elaborate.

    I think that that feeling we get when we hear a strange noise and quickly infer that the house is haunted or someone is in the attic is nothing but the design inference striped to it’s core.

    peace

  14. Corneel: That comment was meant to be tongue-in-cheek, but now I get the impression that you seriously expect to recognise novel mutations by some sense of familiarity instilled in you.

    I think that when we see a non-random non-algorithmic pattern we do recognize something of ourselves. That is why I said that for me the design inference is tied up with my own personal theory of mind. I’m not an algorithm and my behavior is not random.

    We see the marks of behavior similar to our own and infer a mind is behind it. In folks with autism or schizophrenia this instinct is partially broken but we are all hardwired to do so.

    peace

  15. fifthmonarchyman: Here is an interesting article that asks if we can build a computer that demonstrates free will.

    Seems silly.

    The big difference between us and computers, is that computers use logic while we use pragmatics.

    Yes, we sometimes use logic — when it is pragmatic to do so.

  16. fifthmonarchyman: I think that that feeling we get when we hear a strange noise and quickly infer that the house is haunted or someone is in the attic is nothing but the design inference striped to it’s core.

    That is different from being startled by a “strange rustle in the bushes”. Animals do that as well, and they do not believe in ghosts.

  17. fifth:

    I think that when we see a non-random non-algorithmic pattern we do recognize something of ourselves.

    Poor fifth still hasn’t grasped that

    a) every pattern can be produced by an algorithm, and
    b) every pattern can be produced by a random source (provided that the distribution doesn’t rule the pattern out).

    If fifth were competently applying his own criteria, he would never infer intent.

  18. fifthmonarchyman: I think that when we see a non-random non-algorithmic pattern we do recognize something of ourselves. That is why I said that for me the design inference is tied up with my own personal theory of mind. I’m not an algorithm and my behavior is not random.

    You recognise this as a part of yourself, do you?

    GAACTCTGAATGACCCCTGTGGGTTTGAGAG
    AAGAGAAGCAGGAACTTGAGAGAGGAGGAA
    GAGAGAAAGTAATTAAAATGTATCGTTTTAACT
    TAATATTTAACCGAATGATAGCAAAATCTTATC
    TGAAATTGGAAAAGTCAAGGTTTTGAGTGCTG
    GTTCGGTGCCCATTTCTTTATGATTTGATAGTC
    TGAGAAGAATACGACGGGTGTGGCTTAAAAA
    CCTAGATCACGTGTGTAGTTGGAATTGGGTGTT
    ATATGAGCAAACAAAATAAATACCTGTGCAACA
    TACCTGCTTTATGCACTCAAGCAGAGAAGAAAT
    CCACAAGTACTCACCAGCCTCCTGGTCT

  19. Corneel: You recognise this as a part of yourself, do you?

    GAACTCTGAATGACCCCTGTGGGTTTGAGAG
    AAGAGAAGCAGGAACTTGAGAGAGGAGGAA
    GAGAGAAAGTAATTAAAATGTATCGTTTTAACT
    TAATATTTAACCGAATGATAGCAAAATCTTATC
    TGAAATTGGAAAAGTCAAGGTTTTGAGTGCTG
    GTTCGGTGCCCATTTCTTTATGATTTGATAGTC
    TGAGAAGAATACGACGGGTGTGGCTTAAAAA
    CCTAGATCACGTGTGTAGTTGGAATTGGGTGTT
    ATATGAGCAAACAAAATAAATACCTGTGCAACA
    TACCTGCTTTATGCACTCAAGCAGAGAAGAAAT
    CCACAAGTACTCACCAGCCTCCTGGTCT

    I don’t know about anybody else, but I immediately thought FMM (or at least part of him) when I saw that.

  20. fifthmonarchyman: Do you actually want to claim that a sphere is not a pattern?

    peace

    Since I’m not a blithering idiot, of course I do.* The issue was not, I’d note, whether it’s “a pattern,” so skip that potential goalshift.

    But I’m sure that you have some equivocation that you’d use in lieu of actually using words and concepts properly.

    It gets old, your appalling misuse of thought.

    Glen Davidson

    *Naturally I mean “pattern” in the sense of “presence of a recognizable pattern,” and not that it can’t be a pattern for something, or some other equivocation.

  21. keiths:
    fifth:

    Poor fifth still hasn’t grasped that

    a) every pattern can be produced by an algorithm, and
    b) every pattern can be produced by a random source (provided that the distribution doesn’t rule the pattern out).

    If fifth were competently applying his own criteria, he would never infer intent.

    If he were acting competently, he’d never have come up with such tripe.

    Glen Davidson

  22. fifthmonarchyman: We see the marks of behavior similar to our own and infer a mind is behind it. In folks with autism or schizophrenia this instinct is partially broken but we are all hardwired to do so.

    That’s an argument for getting past our tendencies to misunderstand our world.

    I can see, though, why you might prefer misapprehension of the world to getting to the facts. It’s typical creationist/IDist preference for relying on bias over the facts. “It looks designed” rather than following the data that indicate mindless derivation.

    Glen Davidson

  23. walto: I don’t know about anybody else, but I immediately thought FMM (or at least part of him) when I saw that.

    That is interesting, because it is part of the an alcohol dehydrogenase gene 😀

  24. Corneel: That is different from being startled by a “strange rustle in the bushes”. Animals do that as well, and they do not believe in ghosts.

    We are not talking about the generic feeling of surprise we are talking about inference of intent. That goes for both rustles in the bushes and noises in attic. I can be startled by a gust of wind that I did not expect but that does not mean I will infer that it happened on purpose.

    I’m interested in why I quickly infer intent when I observe a certain kind of phenomena and not when I observe another.

    peace

  25. Corneel: You recognise this as a part of yourself, do you?

    One of the most important aspects of my idea is the representation of patterns in forms that allow for comparison. I don’t know if you are aware but normally I try to place two proposed sequences side by side an see if I can tell the difference between them and if one seems to be more likely to be intentional.

    As for seeing something of myself in the DNA Sequence. I think you have misunderstood me. If I were to infer intent from a particular pattern It would because I recognize it as the sort of thing I might produce. Not because I think it is like me in some way.

    I don’t recognize a painting as a part of myself but I do infer design when I see one because it’s the sort of thing I might do if i was so inclined and had talent to pull it off.

    peace

  26. newton: Certainly an algorithm can produce the pattern

    right therefore I don’t usually infer intent when I see one absent some other context

    peace

  27. Neil Rickert: The big difference between us and computers, is that computers use logic while we use pragmatics.

    We sometimes use logic — when it is pragmatic to do so.

    Computers sometimes use pragmatics — when it’s logical to do so. 😉

    peace

  28. GlenDavidson: The issue was not, I’d note, whether it’s “a pattern,” so skip that potential goalshift.

    Are you sure?

    As I recall I asked you to

    quote:
    Please name a designed object that does not have any pattern whatsoever
    end quote:

    and you provided a picture of a spherical object. In other words an object with the pattern of a sphere.

    peace

  29. GlenDavidson: a) every pattern can be produced by an algorithm,

    There are some patterns that can’t be produced by an algorithm that does not contain the pattern as an input.

    π is a good example, there is no way to produce it comprehensively in the physical universe with an algorithm. The best we can do is approximate it

    GlenDavidson: b) every pattern can be produced by a random source (provided that the distribution doesn’t rule the pattern out).

    The same issue applies, A random source can’t produce the pattern of π comprehensively in the physical universe unless it contains that pattern a priori.

    Never the less we recognize π every time we see a circle.

    peace

  30. GlenDavidson: If fifth were competently applying his own criteria, he would never infer intent.

    You are still falling in to the old “infallible inference” trap. Check it out.

    https://en.wikipedia.org/wiki/Abductive_reasoning

    The design inference as I’m describing it isn’t meant to prove design infallibly.

    If you could infallibly demonstrate that a pattern was designed then you could create an algorithm to produce it thus proving it was not designed.

    The converse is just as self-contradictory , If you could infallibly demonstrate that a pattern was not designed then you could intentionally create an algorithm to invariably produce an output that was not intended.

    On the other hand all I’m trying to do is describe what sort of patterns cause us to instinctively yet tentatively infer design when we encounter them.

    And to understand why that is the case.

    peace

  31. fifth,

    Your previous two comments are replies to me, not to Glen.

    It’s okay to crawl out from behind your Ignore button and admit that.

  32. keiths:

    If fifth were competently applying his own criteria, he would never infer intent.

    fifth:

    You are still falling in to the old “infallible inference” trap.

    No. You’ve told us that you infer design if you think that a pattern is nonrandom and nonalgorithmic. As I’ve explained, every pattern can be produced by an algorithm, and every pattern can be produced by a random source (provided that the distribution doesn’t forbid it).

    Therefore, if you were competently applying your criteria, you would never infer design.

    Your criteria are broken, which is why you are shifting the goalposts. See my next two comments for more on this.

  33. fifth,

    There are some patterns that can’t be produced by an algorithm that does not contain the pattern as an input.

    That’s your first goalpost shift. You started out talking about “non-algorithmic” patterns. Now you’ve shifted to patterns that are algorithmic but that can only be produced by an algorithm that “contains the pattern as an input”.

    But even after your goalpost shift, you’re still wrong. Any specific pattern can be produced by an algorithm, and the algorithm needn’t “contain” the pattern or receive it as input.

  34. fifth:

    π is a good example, there is no way to produce it comprehensively in the physical universe with an algorithm. The best we can do is approximate it

    Another goalpost shift. You started out talking about nonalgorithmic patterns. Now you’re talking about algorithmic patterns, but adding a requirement that they “produce the pattern comprehensively in the physical universe”.

    But if you’re going to shift the goalposts for the algorithm, you need to shift them for the human. Can the human produce the digits of pi, comprehensively, “in the physical universe”? No, of course not.

    Your criterion fails to distinguish a human from the algorithm.

    keiths:

    b) every pattern can be produced by a random source (provided that the distribution doesn’t rule the pattern out).

    fifth:

    The same issue applies, A random source can’t produce the pattern of π comprehensively in the physical universe unless it contains that pattern a priori.

    Ditto. If you’re going to move the goalposts for the random source, then you have to move them for the human source.

    Another failed criterion.

  35. fifthmonarchyman: There are some patterns that can’t be produced by an algorithm that does not contain the pattern as an input.

    π is a good example, there is no way to produce it comprehensively in the physical universe with an algorithm. The best we can do is approximate it

    How would you input PI to an algorithm?

  36. fifth,

    These concepts are obviously very confusing to you, and God certainly isn’t helping by “revealing” stuff to you. By all indications, he never does.

    Perhaps you can find someone else — someone whom God actually favors — to make your case for you, since you can’t do it yourself.

  37. Keiths,

    Once again I will be happy to discuss stuff with you directly if you will just provide a summery of the beliefs that you now embrace as a follower of Rumracket that you once rejected as a atheist.

    That should be a breeze.

    Until you do that it is impossible for me to assume you are posting in good faith.

    I am starting to think that that is how you want it.

    peace

Leave a Reply

This site uses Akismet to reduce spam. Learn how your comment data is processed.