At last?
Back in 2007, I predicted that the idea of “Intelligent Design” would soon fade into obscurity. I wrote:
My initial assessment of ID in my earliest encounter with an ID proponent* was that ID would be forgotten within five years, and that now looks to me an over-generous estimate.
*August, 2005
I was wrong. Whilst the interest in “Intelligent Design” (ID) as a fruitful line of scientific enquiry has declined from the heady days of 2005 (or perhaps was never really there) there remain diehard enthusiasts who maintain the claim that ID has merit and is simply being held back by the dark forces of scientism. William Dembski; the “high priest” of ID has largely withdrawn from the fray but his ideas have been promoted and developed by Robert Marks and Winston Ewert. In 2017 (with Dembski as a co-author) they published Introduction to Evolutionary Informatics, which was heralded as a new development in the ID blogosphere. However, the claim that this represents progress has been met with scepticism.
But the issue of whether ID was ever really scientific has remained as the major complaint of those who dismiss it. Even ID proponents have admitted this to be a problem. Paul Nelson, a prominent (among ID proponents) advocate of ID famously declared in 2004:
Easily the biggest challenge facing the ID community is to develop a full-fledged theory of biological design. We don’t have such a theory right now, and that’s a problem. Without a theory, it’s very hard to know where to direct your research focus. Right now, we’ve got a bag of powerful intuitions, and a handful of notions such as ‘irreducible complexity’ and ‘specified complexity’ – but, as yet, no general theory of biological design.
Whilst some ID proponents – Ann Gauger, Douglas Axe are perhaps most prominent among them – have tried to develop ID as science, the general scientific community and the wider world have remained unimpressed.
Then a new young vigorous player appears on the field. Step forward, Eric Holloway! Dr Holloway has produced a number of articles published at Mind Matters – a blog sponsored by the Discovery Institute (the paymasters of ID) on artificial and “natural” intelligence. He has also been quite active here and elsewhere defending ID and I have had to admire his persistence in arguing his case for ID, especially as the whole concept is, in my view, indefensible.
But! Do I see cracks appearing? I happened to glance at the blog site formerly run by William Dembski, Uncommon Descent, and noticed an exchange of comments on a thread entitled Once More from the Top on “Mechanism” The post author is Barry Arrington, current owner of UD and a lawyer by trade, usually too busy to produce a thoughtful or incisive piece (and this is no different). However, the comments get interesting when Dr Holloway joins in at comment 48. He writes:
If we can never be sure we account for all chance hypotheses, then how can we be sure we do not err when making the design inference? And even if absolute certainty is not our goal, but only probability, how can we be confident in the probability we derive?
Eric continues with a few more remarks that seem to raise concern among the remaining regulars. ( ” Geeze you are one confused little pup EricMH.” “Has a troll taken over Eric’s account?) and later comments:
But since then, ID has lost its way and become enamored of creationism vs evolution, apologetics and the culture wars, and lost the actual scientific aspect it originally had. So, ID has failed to follow through, and is riding on the cultural momentum of the original claims without making progress.
Dr Holloway continues to deliver home truths:
I would most like to be wrong, and believe that I am, but the ID movement, with one or two notable exceptions, has not generated much positive science. It seems to have turned into an anti-Darwin and culture war/apologetics movement. If that’s what the Discovery Institute wants to be, that is fine, but they should not promote themselves as providing a new scientific paradigm.
I invite those still following the fortunes of ID to read on, though I recommend scrolling past comments by ET and BA77. Has Dr Holloway had a road-to-Damascus moment? Is the jig finally up for ID? I report – you decide!
ETA link
Alan Fox,
Lets start that a mind is mechanism that can:
Sound reasonable?
Well, I’ll agree that, assuming that “mind” means “what the brain does”, the mind can do things. The issue is whether you mean what I mean when you say “mind”.
You’re erecting a straw-man!!!!!!! ID is not about The Designer!!!!!! You’re not allowed to try and discuss The Designer at all you evil materialist!!!!!!!
Just to clarify, I do think there is design happening in this Universe. We are being designed. Other organisms are being designed. The mechanism is adaptation. The non-random element, the design, is provided by the environment, the niche.
That’s exactly what Luria and Delbruck did when they looked at how adaptions arose in bacteria. They modeled both stochastic and non-stochastic processes, and the evidence supported the stochastic model (i.e. a Poisson distribution consistent with a background random mutation rate).
Natural selection would also seem to be a non-stochastic process. For example, we see a non-stochastic distribution of fur color in pocket mice due to predatory pressure:
https://www.pnas.org/content/100/9/5268
I’m not sure why you think methodological naturalism assumes stochastic processes when there are many non-stochastic processes found in scientific theories.
So it would seem! 🙂
I agree, but I think it’s a safe to say that most of those poor kids have been indoctrinated beyond repair, if they’re taking courses from a YEC like Nelson. In fact, I bet they feel like they’re supposed to fail to properly address Nelson’s challenge, you know.
Where did EricMH get his education? I’d want my money back if I was him. MN is based on the assumption that everything is a stochastic process? Where the fuck do these nutters get these ideas?
That’s not the case at all. There are many examples of people emerging out of the creationist community and pursuing fruitful scientific careers. Some people have crises of faith when they move outside the protective echo chamber of creationism, and the blame for that can be laid squarely at the feet of creationists.
I may be an atheist, but science is not an atheistic profession. There are thousands and thousands of amazing christian scientists who comfortably meld their work with their religious faith, even in the biological sciences. The only group making evolution a stumbling block for Christians is ID/creationist organizations.
T_aquaticus,
I would refer you to the Fourteenth Dalai Lama who wrote:
link
T_aquaticus,
jazz said most, and I agree. It depends on how profound the indoctrination is, of course. Most of Christianity is very well domesticated, and thus doesn’t pursue direct conflict with science. But if you’re under a very deeply committed YEC community and educational system, it can be very hard to get out.
That would demonstrate methodological naturalism is false, insofar as methodological naturalism is predicated on the claim ‘everything is stochastic.’ It would also substantiate the idea that ‘methodological naturalism’ is actually a fiction.
To clarify, ‘stochastic process’ is the most general way of characterizing anything that operates according to chance, determinism, or some combination thereof. So, it includes both processes that are entirely deterministic and entirely random.
We know that the physical laws are entirely stochastic in the meaning I define above. Thus, if we ever identify anything non-stochastic, that means it must have a cause that lies outside the physical plane.
Thanks for not sealioning by feigning politeness!
Any time buddy. Any time.
Methodological naturalism doesn’t require all processes to be stochastic. I don’t know where you are getting this requirement from.
That begs the question of what a non-stochastic process would be. Care to take a stab at that one?
Could someone explain the difference between “stochastic” and “random”?
Let’s look at stochastic and nonstochastic health effects of radiation exposure.
“Unlike stochastic effects, nonstochastic effects are characterized by a threshold dose below which they do not occur. In other words, nonstochastic effects have a clear relationship between the exposure and the effect. In addition, the magnitude of the effect is directly proportional to the size of the dose. Nonstochastic effects typically result when very large dosages of radiation are received in a short amount of time.”
https://www.nde-ed.org/EducationResources/CommunityCollege/RadiationSafety/biological/nonstochastic/nonstochastic.htm
Stochastic effects include an increase in mutations with an increase in dosage. Nonstochastic effects have a threshold. Below a certain threshold and you don’t get the effects.
My question to EricMH is this. Are the nonstochastic effects of radiation exposure point to radiation coming from outside the physical realm? Is science incapable of studying the impact ionizing radiation has on human health?
The antonyms in this case would be stochastic and deterministic. EricMH seems to be unaware that these are opposites.
This is an abuse of generally accepted language. Deterministic is a sub-set of stochastic? Absurd.
Please find a different term for what you mean to say, or we’ll again be having endless confusion and pointless arguments about terminology instead of talking about actual ideas.
(cough) supernatural (/cough)
To those lamenting those poor & misled Discovery Institute summer seminar students: Very few of the students are undergraduates. Most are graduate students, post-docs, or junior faculty. Even fewer are YECs, and many are quite well-schooled in evolutionary biology, genetics, and other specialized disciplines of biology. These kids are sophisticated and highly critical.
They are also fiercely independent thinkers, and (for that reason) like to try out heretical ideas, such as the possible falsehood of universal common descent (UCD). This talk on UCD, while dated now (I gave the lecture in southern Poland in June 2015), is nonetheless quite similar to what I present in one of my two customary lectures at the seminar (the other concerns animal macroevolution):
Watch it. You will find nothing about YEC, no mockery of evolutionary theory, plenty of interesting biological puzzles and data. This is what the kids get in Seattle every summer, albeit updated to reflect new findings.
To T. aqua — if UCD has the explanatory / predictive power you claim, you shouldn’t have any trouble performing my thought experiment. Josh Swamidass tried it, and told me in response that UCD wasn’t so much a predictive theory as it was an “explanatory framework.” John Harshman tried it, and told me I had rigged the exercises by cherry-picking examples to flummox UCD.
But it shouldn’t be possible to flummox UCD, right? We are talking about the most basic claim of evolutionary theory, namely, the universal relatedness of living things, descended from LUCA.
Entropy, if “noise” explains the anomalous character distributions, then we should have a sub-theory enabling us to separate signal from noise, allowing strong and accurate predictions (i.e., the signal) from UCD.
T aqua, I can understand that you want to protect your real identity. So just make up a throwaway Google Mail account, use that, and I’ll send you the thought experiment. My email: nelsonpa@alumni.uchicago.edu. Same offer for anybody else reading this thread.
EricMH or anyone else want to take a crack at answering this?
I’m sorry to hear that your students at the DI summer seminar don’t know much about inference of phylogenies. The standard today is to do it statistically using probabilistic models of change of the characters, such as the bases in a DNA sequence. Each possible phylogeny (or any nontreelike genealogy that is well-specified) generates a set of probabilities for all possible combinations of bases, indicated by the letters A, C, G, and T.
For example, if we have a tree with species X and Y close together, and Z and W close together, but these two clades much farther apart, the probability of the pattern AAGG will be much higher than the probability of AGAG. But for a tree with X and Z close together and Y and W close together, AGAG would be have the higher probability.
It sounds as if your students don’t realize how these methods work or that they rely on each hypothesis of a genealogy of descent leading to a probability distribution on all possible DNA base patterns.
And by the way, whether common descent is Universal is not at issue, one only needs to consider common descent for the particular group of organisms under study.
There is none, but Eric uses “stochastic” here to include all (partly) deterministic processes as well. That seems to be an accepted use of the term in mathematics. I recall the rather knowledgeable commenter Simon Gunkel once stating something similar at Larry Moran’s Sandwalk blog.
It is an interesting question indeed what a non-stochastic process would look like. If you remember, here at TSZ we had FifthMonarchyMan claiming that chosen patterns could be distinguished from random and deterministic patterns (something to do with free will). He never quite succeeded in demonstrating how that was done. Perhaps Eric fares better. I hope we get to see him try at any rate.
I’ll send you the thought experiment. The exercises start with a published, or generally accepted, phylogeny. Then some of the character distribution is masked, and students are asked to predict the character, or character state, in the masked portion.
Try it yourself, after it arrives in your email.
Just a couple of exercises concern universal common descent (in the precise sense of descent from LUCA); the others assume only the monophyly of particular clades.
Nah, we value candour!
Hey Paul. You make some rather strange claims in your video. For example, you say that it was initially stated that if common descent is true, one should not find incongruent phylogenies(leaving the weird impression that there is no such thing as degree). And that later the paradigm “swelled” to account for this violation of the initial prediction.
But Paul, I’m pretty sure that’s not true. Perhaps you can disabuse me of this misconception of mine. Can you point out where and when these initial predictions were made, and approximately when in time it was later changed?
I also find your paraphrase of the interaction between Richard Dawkins and Craig Venter to be highly… shall we say creatively reinterpreted?
Alan sees a sealion.
You’re mistaken.
Do your homework.
Oh well if you’re going to just insist why even have any discussion? Can you give a reference? I can’t do my homework if I don’t know where to look.
Entropy,
Let’s start here. Point me to a model and not a story to how complex adaptions happen. One that generates the complex functional sequences we observe.
Which thought experiment are you talking about?
I don’t see why you can’t explain it here.
Exactly. If it isn’t random, deterministic, or a combination of the two, then what can it be?
The prediction is that the unmasked characteristics will fall into a statistically significant phylogeny if it is a set of species that evolved from a common ancestor. Having incomplete information does not change or falsify this prediction.
There have been many occasions where biologists have had incomplete data sets that precluded them from constructing a tree. I don’t see how this is a problem for the theory of evolution or UCD.
In any case, it’s really not difficult to find examples of similar sequences with poorly resolved trees. Particularly when we are talking about universal common descent, we are likely talking about the monophyly of bacterial and archaeal sequences.
It is not a particularly revealing or interesting fact that you can find trees with bad support between those clades(or, heck, even within each of them). What’s more interesting is that you can also find trees with much better support, and that there is a statistically significant central trend among such trees. And that internal nodes in the trees for either clade, inferred independently of each other and without using any outgroup rooting, nevertheless exhibits ancestral convergence between them.
Corneel,
T_aquaticus:
The product of non-physical libertarian free will, according to Eric. Unfortunately for him, the concept of libertarian free will is incoherent.
What was wrong with the last several hundred times you made the same demand and were answered?
Here’s one you could have found yourself with a simple search.
Evolution of species from Darwin theory: A simple model
Here’s another
Adaptive Evolution Model
I’ve watched some of it. Why is it that, when I google the scientists you quote there, they never seem to say what you claim they say? An example here (Kenneth Weiss):
http://molecularevolutionforum.blogspot.com/2012/05/how-can-there-be-orphan-genes.html
Wow. That’s one of the clearest examples of dishonest quote-mining by a Creationist I’ve ever seen. Nelson only gives Weiss’ framing of the issue then completely omits the explanation Weiss presents immediately after.
Still YECs like Nelson wonder why so many people consider them intellectually and morally bankrupt.
Adapa,
What new real novel biological function do these models deliver? A toy model does not validate a hypothesis. If Entropy can come up with one then the next exercise is to test the model. This gets back to what mechanism generates de novo functional information.
This is what I think Eric is asking for a non stochastic mechanism or deterministic mechanism.
LOL! Why did I know you’d hand wave away the scientific models of evolution once again and stick to your willfully ignorant bleating? 🙂
Tell us again why empirically observed gene duplication followed by point mutations to the copy doesn’t count as new functional information.
Adapa,
This is more likely a loss or no change in information. If this process continues it will devolve information given the chance of information loss is much higher than information gain.
The only system I have seen that can find a functional linear sequence through an algorithm that can be repeated required the sequence to be a target in the algorithm.
Sorry, Rum — I apologize for my impatient reply.
Evolutionary biology textbooks of the 1970s and 1980s generally claim strong or even total congruence of molecular and morphological phylogenies, with some additionally explaining that this represents a striking confirmation of Darwin’s Tree of Life prediction (namely, that further work in biological classification and systematics would increasingly conform to a great branching tree, with a single root). These claims would begin to fray in the 1990s, as molecular data accumulated and incongruence began to appear in different parts of the Tree.
Fast forward to 2013, and a review article on the Tree of Life (ToL) by evolutionary biologist David Mindell (UC-San Diego). He writes:
“The ToL has expanded greatly in scope over recent decades, adding increasing numbers of genes, genomes, and new organismal groups to its purview. The kinds of evolutionary lineages (and biodiversity) that the ToL is expected to track through time have expanded as well, growing from organismal lineages alone, to organismal plus molecular sequence lineages. The fact that organismal and sequence lineage histories often differ, and the fact that the ToL has a long history of use by biologists, underlie debate over its current nature (e.g., Doolittle 1999; O’Malley and Boucher 2011). Recognition of widespread reticulate evolution arising from LGT has lead to criticism of the ToL as disproven or restricted in scope, applying to some life forms but not others. Is the ToL obsolete as either a metaphor or model? Not at all. I argue here that the ToL is thriving” (p. 486).
So is the ToL geometry false? No, says Mindell — because, in his estimation, the ToL is NOT a “falsifiable hypothesis”:
“In this article, I argue for a pluralistic view of the ToL, not as a falsifiable hypothesis about the nature of the branching patterns, but as a broad metaphor for life’s common descent, and as an ongoing effort to model genealogical relationships, such as reticulations, for molecular and organismal lineages.” (p. 479)
The outer boundary of the domain of universal common descent (UCD) swells, and thereby accommodates anomalous data. The ToL is still the case, because it’s a “broad metaphor.”
I can send you this article, which is paywalled. D.P. Mindell, “The Tree of Life: Metaphor, Model, and Heuristic Device,” Systematic Biology 62 (2013):479-489. What I am describing in the talk, of course, is a very wide change of emphasis within evolutionary theory over the past three decades, and could fill a book or two. MANY parts of the literature could be cited; this is just a tiny representative sample.
How can it be a loss or no change of information when you’re increasing both the length and complexity of the genetic sequence AND producing a new function as well?
Do you ever do anything but make these hand waving denials?
Except NATURAL SELECTION is acting on the variants and keeping the ones which function better. Again this is all empirically observed in real word examples.
I do believe if you ever once acknowledged the effects of feedback from natural selection your Creationist head would explode. 🙂
Maybe because that blog post by Weiss is not the article I was citing?
See Kenneth Weiss, “To understand the baboon,” Evolutionary Anthropology 21 (2012):131-135. Here is the full citation (from p. 134):
“Such methods are implicit uses of the brilliant Darwinian insight. Deduction is also used in many other ways, for example by using known patterns of regions of DNA that code for proteins to identify new coding regions in a newly available sequence, even for proteins that have never been seen before.”
“We can see this in a different way from the following little sequence: GGGCTATTCAACGAGCCTAGGCTA TACGCTACTGACCTGTCACGCCTTT GCT. The Genbank DNA sequence repository (http://www.ncbi.nlm.nih.- gov/ genbank/) reports that there was ‘‘no significant similarity found’’ between this and any known sequence. That is rather remarkable, given how much sequence there is on file from essentially every major branch of the tree of life, and that similarity searches allow for some mismatches. If this were from a reptile or tree species, a bird, fish, or fowl, grape, grain, or maiden, we should be able at least to see its similarities to the appropriate most-closely related species. But…nothing.”
“If our theory of life is even remotely correct, such a result is exceedingly hard to explain other than by assuming that there is a branch of life unrelated to anything yet discovered; this is from part of the genome that hasn’t been sequenced before in any species even modestly related to the sample; there is an entirely independent type of DNA-using life dropped here from outer space; or I made it up. You decide. Life as history is so nonrandom that even the observed randomness of DNA sequence is nonrandom.”
“An actual case in point involves so-called orphan genes, found in one species or taxonomically restricted group but having no known relatives anywhere else in the biosphere. Orphan genes may have had some narrow adaptive function that was important to the evolution of their species, explaining their absence elsewhere. But that seems to challenge the fundamental assumption of the evolutionary method, that life is a single universally connected phenomenon. Where would such genes have come from, leaving no trace in other taxa?”
Weiss then speculates about possible evolutionary processes which could have given rise to orphan genes, and concludes that, whatever the evidence, orphan genes are still fully consistent with the Darwinian picture of life. “Orphan genes,” he writes, “require no suspension of the rules of life and make no rent in the connected fabric of life. Indeed, understanding them actually shows the Darwinian method in action.”
Thus, Weiss — unlike other biologists who have let molecular anomalies carry them away from the single ToL geometry — even as he recognizes the deep puzzle orphans pose, allows the UCD sphere to swell and take them in.
A point mutation does not change the length of the duplicated gene. You need to demonstrate that this process can generate a new gene family. It can possibly create a modified enzyme but this does not cover the diversity we are observing.
When in doubt reach for your magic wand :-). You need to get to function before natural selection has a chance to be part of this process.
But the duplication event does. Duh.
ZOOM! go Bill’s rocket powered goal posts! From “evolution can’t create new information” to “you need to show a whole new gene family”. 😀
Your lame excuses for dodging the effects of NATURAL SELECTION keep getting funnier every day Bill. You should write speeches for Trump.
Damn Bill there are whole textbooks written on the subject.
Evolution After Gene Duplication
I’ve never met anyone so happy to stay willfully ignorant.
In other words you quote-mined him out of context in your presentation to produce a deliberately false picture of his views on orphan genes.
Do you realize most people consider quote-mining to be a form of lying?
For ID to be in demise one would not know from such a quick collection of posts.!!