Jonathan McLatchie still doesn’t understand Dembski’s argument

Over at Uncommon Descent, Jonathan McLatchie calls attention to an interview that Scottish Christian apologist David Robertson did with him.  The 15-minute video is available there.

The issue is scientific evidence for intelligent design.  As so often occurs, they very quickly ran off to the origin of life, and from there to the origin of the Universe.  I was amused that from there they tried to answer the question of where God came from, by saying that it was unreasonable to push the origin issue quite that far back.  There was also a lot of time spent being unhappy with the idea of a multiverse.

But for me the interesting bit was toward the beginning, where McLatchie argues that the evidence for ID is the observation of Specified Complexity, which he defines as complex patterns that conform to a prespecified pattern.  He’s made that argument before, in a 2-minute-long video in a series on 1-minute apologetics.  And I’ve complained about it before here.  Perhaps he was just constrained by the time limit, and would have done a better job if he had more than 2 minutes.

Nope.  It’s the same argument.

His Specified Complexity argument is William Dembski’s pre-2005 argument.  It turned out that the argument required a conservation law to show that natural selection could not put this Specified Complexity into the genome.  Dembski did have such an argument, but it turned out not to work (see my 2007 article for the details).

In 2005-2006 Dembski changed the argument, by redefining Specified Complexity to have an additional condition.  Now you could only call a pattern Specified Complexity if it was not only complex and conformed to a prespecified pattern but also could not be brought about by natural evolutionary forces such as natural selection.  A number of people here and at Panda’s Thumb pointed out that this fails to show us how this condition is to be evaluated.  It makes SC something that comes in after one has somehow decided that an adaptation cannot have been achieved by natural selection.  In short, it has been safeguarded against the criticism that evolution could bring about SC by defining the issue away.  That makes SC a useless criterion.

But McLatchie has somehow missed all this history.  He is back where Dembski was in the book No Free Lunch: Why Specified Complexity Cannot be Purchased Without Intelligence, published in 2002.  McLatchie has totally missed both the refutations of Dembski’s original criterion, and the 2005-2006 fix that rendered the SC criterion useless.  In spite of having 15 whole minutes to clean up the mess, McLatchie and Robertson preferred to spend the extra time back at the origin of the Universe.

480 thoughts on “Jonathan McLatchie still doesn’t understand Dembski’s argument”

  1. colewd:
    Allan Miller,

    I agree with this.At what point does sequence divergence lower the probability of common decent?

    At what point does sequence divergence lower the probability of plagiarism?

    Basically, it immediately lowers it ever so little, but it remains powerful evidence until it becomes statistically meaningless.

    Much of jurisprudence would become impossible if IDist/creationist objections were universalized, rather than directed at the “enemy” of evolutionary theory.

    Glen Davidson

  2. Digital database fingerprint matching is based on 13 points of matching. In actual trials, fingerprint images will be superimposed, whenever possible, but the automated search for matches uses just a few points.

    Pretty much the same for DNA matches. The rate of divergence assumed for common descent matches the rate of divergence seen in long term evolution studies, such as Lenski’s.

  3. OMagain: The same cannot be said of design as it does not need nor require intermediaries

    Not all possible designers are omniscient and omnipotent. Some design like evolution could require intermediates, perhaps as an economic consideration.

  4. newton: Not all possible designers are omniscient and omnipotent. Some design like evolution could require intermediates, perhaps as an economic consideration.

    Yes indeed. Because the Designer has to keep track of tens of thousands of traits in millions to billions of species. That is not only going to be incredibly tiring, but also hellishly expensive. So we definitely expect that there will be some substandard shortcuts taken. It’s good to see that ID makes some substantive predictions.

  5. colewd: I have not proposed any designer.

    Sure you have. You know, the designer that designed the intelligent design!

  6. phoodoo: That Shapiro and others don’t want to openly admit this is not surprising at all, since he works at a major university where he would probably lose his job if he did.

    Heh.

  7. newton: Some design like evolution could require intermediates, perhaps as an economic consideration.

    Sounds like an ID project to me then. It seems to me that we can determine some things about the designer already.

    A) The designer does not mind designing species incrementally for many millions of years that eventually die with no descendants.

    B) The designer is alive for those millions of years.

    From A) We could infer that there is no special specialness about any particular species, if any or all can go extinct even after many millions of years of ‘design-time’ has gone into them. Therefore we can infer that there is nothing special about human beings in their current form.

    Perhaps, then, rather than a blind watchmaker the designer of ID is an idiot-savant watchmaker. And from B) we can infer they will be around for many millions of years after human beings are extinct, providing further support for the idea we are just inconsequential.

  8. newton: Some design like evolution could require

    Or invisible pink unicorns! That’s the trouble with ‘could’

    Once again it illustrates the fact that ID supporters are usually ID supporters despite and not because of the evidence.

    phoodoo: I am not buying into this crap that one can say, oh well life just makes itself happen, that doesn’t mean there is a designer.

    Fer’instance.

  9. The designer that designs new organisms by incremental derivation of previous designs, such that they can be objectively fitted to a nesting hierarchical pattern of shared derived characteristics is called EVOLUTION.

  10. On intelligent design you expect EVERYTHING to happen. Or more correctly, you expect NOTHING IN PARTICULAR.
    No pattern is any more expected than another. All patterns are after-the-fact compatible with design, but none of them are exclusively or statistically predicted to appear over others.

    Yes, design CAN explain all the same observations as evolution by common descent. But only in an empty and ad-hoc fashion that lacks explanatory power. (As in, it doesn’t actually explain or predict why we see what we see). “That’s just the way the creative designer wanted to make it”. There is no WHY or HOW in the design-rationalization.

    Further more, why do human beings (the only intelligent designer we know of empirically) use “common design”? Mostly to save time and resources. Human beings copy previous designs because it is simply faster to do so when they need to make something that works. Nuts and bolts are reused because they work fine as they are, no need to change them. They are standardized, the factory has no good reason to invent new, sliiiiightly different ones every time. Wheels are good for vehicles, easy to copy the basic pattern and save time, instead of having to re-invent a new method of locomotion every time. And build an entirely new factory to produce them.

    But, life wasn’t designed by humans, so we can’t use analogies to anthropomorphic tendencies with respect to design. The kind of designer most ID proponents think designed life is an omnipotent supernatural designer, unconstrained by a faulty or mediocre imagination, unconstrained by a lack of time, unconstrained by resources, unconstrained by materials or anything at all. Such a designer would have absolutely no practical reasons for copying it’s designs over and over again in a derivative fashion by re-using and slightly altering items and structures from previous designs, to include in new organism that appear as evolved derivations of previous ones. None of the inferences we use to infer human design took place, are valid inferences for an unconstrained, omnipotent divine designer who does not have human concerns of practicality such as resources, lack of intelligence, imagination, creativity and time.

    A problem I see is the colossal ambivalence at the heart of the main ID proponents, who start with a conclusion that a specific and supernatural designer did the designing. This leads them into problems very quickly, for among other reasons that the nature, capacities and intentions of their designer, they assert, is unknowable, infinite and mysterious, respectively.

    But in science we work with what we got and from what we know:
    Observed designers, observed natural processes, observed manufacturing processes leaving observational evidence behind. The mechanism is understood, it makes testable predictions. It fits into already well-established frameworks of science from other fields: Physics, chemistry etc.(And in the case of human designs, human psychology, human inventions and technology and human culture). We can then form hypotheses and look for the results of the mechanism and either confirm or falsify the hypothesis.

    Now comes “ID”. Do it have a mechanism? Nope.

    What did it make? Depending on who you ask, all living organisms as-is, or occasionally it just dropped in to magically instantiate specific mutations at various points in the history of life, or zap a flagellum into existence.

    Does their designer leave a signature, product description or trademark behind?(Stainless Steel, Goodyear, Firelli, Made in Taiwan, Nike, Microsoft, Coca Cola, nVIDIA… ) Nope.

    Does it use tools? Nope (or no idea, things magically appear with no process of fabrication and construction).

    When did it operate? No idea, millions and billions of years ago and now it’s suddenly stopped entirely no new creations take place. No creation has ever been observed. No macro-creation, not even micro-creation. Simply put, we observe absolutely nothing at all that looks like it is being instantly created with divine magic.

    Do they draw analogies to human manufacturing processes? Well, they sometimes say that the designer re-uses old designs. What reasons do they have to expect their designer to do this? Since they don’t know the designers mind or intentions (they keep saying this to secular audiences), then they must be getting their idea from having seen human beings design things.

    Ok, let’s just run with that. Let’s try the “accepts common descent and some degree of evolution but occasionally dropping in to make specific mutations happen or instantly create a flagellum 2 billion years ago” (theistic evolution). What testable predictions does this make? It should look exactly like evolution happened.
    Just like evolution could have created all of life through mutations, drift and selection, with all the minor quirks and oddities being the result of incomplete lineage sorting, convergent evolution, drift, horizontal gene transfer and so on,
    all expected to happen but never statistically significantly deviate from the main pattern, so does theistic evolution become observationally indistinguishable from naturalistic evolution.

    In other words, an unobserved designer operating in the deep geological past, on a global scale, who has the ability to make specific mutations happen inside living organisms, is in competition with the observed fact that evolution happens naturally:

    A) Mutations observationally happen, and we have no good reason to think they wouldn’t in the past too.
    B) Those mutations affect the morphology and the physiology of the host organisms, and we have no good reason to think they wouldn’t in the past too.
    C) The phenotypical and morphological effects of those mutations affect the reproductive successs of the carrier organism, and we have no good reason to think it wouldn’t in the past too.
    So simply put, drift and selection observationally happens, and we have no good reason to think it wouldn’t in the past too.
    E) Environments observationally change, and we have good reason to think they did in the past too (all of geology and the Earth-sciences testify to this).
    F) Horizontal gene transfer observationally happens, and we have no good reason to think it wouldn’t in the past too.
    G) Incomplete lineage sorting observationally happens, and we have no good reason to think it wouldn’t in the past too.
    H) Convergent evolution observationally happens, and we have no good reason to think it wouldn’t in the past too.

    Which is the simplest, most parsimonious explanation of the observed shared derived characteristics in extant life, then? The observed one that doesn’t require us to erect uneconomical unobserved entities: Evolution.

    Ok, fuck that then. Moving on to the “all life made as-is” (space-aliens with superduper technology-ID-creationism).

    Well, we should expect to find similarities between some species(still re-using old designs).
    Ok, we find that. But we have at least two hypotheses that predict this same feature, so can we distinguish between them? Well, evolution predicts congruent nesting hierarchies in morphology, anatomical features and genetics.

    But designers have been known to design nested hierarchies too.

    Sure, but again the reasoning is arrived at ad-hoc. Mere re-using of old designs should not in itself yield highly congruent multiple nesting hierarchies into which all of life fits to an extremely high degree of confidence.

    No, but it still could have been designed.

    Yes! But why would we believe it was beyond the mere possibility? What grounds are there to believe that this is what happened? What are the odds that, even if you as a “designer” sits down and thinks “I’m going to reuse some of my older designs”, inadvertently produces a nested hierarchy, into which every species on the planet fits, both genetically, morphologically (and chronologically in the fossil record)? And why would you do it deliberately? What are the odds that your designer sat down and designed this specific pattern?

    Does the observed nested hierarchy even make sense with respect to known, human designers method of design and manufacture?

    Let’s see:
    A look into the mind of the designer of the nested hierarchy:
    “Common design – common designer” (by deliberately forming sets within sets within sets).

    Here’s a small insight into it’s train of thought (courteously trying to give ourselves reason to entertain the design hypothesis by drawing from the only intelligent designer we know of – Homo Sapiens):

    Oh, I’m going to design a bacterium with a genome like this (the first genome!).
    AAAGGGCCCTTTAAGGCCTTAGCT

    Oh, I want to design another organism, re-using some of my bacteria designs(the “common designs”-argument), so it looks like this new organism genetically and morphologically mostly derives from the first one.
    AAAGGGCCCTTTAAGGCCTTAGCA

    Oh, I’m going to design a 3rd organism, this time re-using designs from the 2nd organism, so it looks like it mostly derives from the 2nd one.
    AAAGGGCCCTTTAAGGCCTTACCA

    Oh, I’m going to design a 4th organisms, this time re-using designs from the 3rd, so it looks like it mostly derives from the 4th one.
    AAAGGGCCCTTTAAGGCCTAACCA

    Oh, I’m also, intermittently, going to go back and re-tweak my previous creations, so that it looks like they each independently changed since I first created them.
    1st Organism: TAAGGGCCCTTTAAGGCCTTAGCT
    2nd Organism: ATAGGGCCCTTTAAGGCCTTACCA
    3rd Organism: AATGGGCCCTTTAAGGCCTTACCA
    4th Organism: AAAGGGCCCATTAAGGCCTAACCA

    Not only am I going to do this, mysterious designer as I am, I’m going to do it in such a way that the degree of change it looks like they underwent, is directly proportional to how old their time of divergence will look like if calculated from number of nucleotide substitutions(and estimated from the fossil record). Haha, take that – future humans whom I’m going to create at some point too!

    Anyway, back to business, creating a 5th organism, this time re-using designs from the 4th, so that it looks like it mostly derives from the 4th one.
    ACAGGGCCCATTAAGGCCTAACGA

    Oh, I just got a brilliant idea! I’m going to go back to the first organism I designed, and then derive a whole new “branch” from it. But I’m not going to be deriving this branch from the original genome I first created, no, I’m going to change it slightly so it looks like that first genome evolved for a time before this new “divergence” happened, THEN I’m going to make the new “branch”.
    1) TTAGCGCCCTTTAAGGCCTTAGCT
    1a) TTAGCGCCCTTAAAGGCCTTAGCT (independently derived from 1)
    1b) TTAGCGCCCTTTATGGCCTTAGCT (independently derived from 1 also)
    There, perfect!

    Oh, I just got another brilliant idea. In addition to the intermittent return to tweaking the genomes of previously designed organisms, I’m going to do the exact same I just did to the first lineage: Intermittently derive more independent branches off of each of the 2nd, 3rd, 4th, 5th (and so on) “linages” I created, using the same hilariously illogical method I just used to create a branch off of the 1st one. Brilliant!

    And I’m going to do this for millions and millions and millions of species. And to top it all off I’m going to kill billions of them in intermittent extinction events, burying them in the millions in seemingly temporal order matching with morphological and genetic sequence, so that it just so happens to look like they left incrementally changed descendants over a very long timescale.

    I wonder what the odds of me creating and designing life, exactly using this method is? I wonder if it even makes sense to postulate that anything would do “design” like this? Hmmm.

    Does this make sense to postulate? No, it doesn’t. No mentally healthy intelligent designer would operate like this and produce a nested hierarchy indistinguishable from the one produced by the evolutionary process.

    I submit that if you can convince yourself that your designer operated like this, then you’re either insane, deluded or infinitely gullible. Regardless, it would be irrational to believe it.

  11. phoodoo: That Shapiro and others don’t want to openly admit this is not surprising at all, since he works at a major university where he would probably lose his job if he did.

    Last I checked Michael Behe still has his job.

  12. Rumraket,

    Excellent comment. I hope colewd and Sal will take the time to really ponder it, along with anyone else who mistakenly believes that ID is a viable explanation for the pattern of life on earth.

    One small point of disagreement, though. You write:

    Ok, let’s just run with that. Let’s try the “accepts common descent and some degree of evolution but occasionally dropping in to make specific mutations happen or instantly create a flagellum 2 billion years ago” (theistic evolution). What testable predictions does this make? It should look exactly like evolution happened.
    Just like evolution could have created all of life through mutations, drift and selection, with all the minor quirks and oddities being the result of incomplete lineage sorting, convergent evolution, drift, horizontal gene transfer and so on,
    all expected to happen but never statistically significantly deviate from the main pattern, so does theistic evolution become observationally indistinguishable from naturalistic evolution.

    That’s not quite right. A designer who occasionally drops in to create specific mutations will still mess up the signal of the objective nested hierarchy unless he is careful to mimic naturalistic evolution.

    He isn’t limited to mutations that are naturalistically possible, and he can create giant, intricate mutations in a single poof. He can also arrange for probabilistically unlikely mutations to happen in conjunction with each other. Third, he can step in and rescue mutants that are about to go extinct, and he can zap their competitors (or predators) if necessary.

    Unless all of these activities are constrained to match what would be possible naturally, the signal of the objective nested hierarchy may be lost.

    The upshot is that theistic evolution should be observationally distinguishable from unguided evolution, unless God is an obsessive mimic of naturalistic evolution.

  13. It’s good to see that ID makes some substantive predictions.

    I presume this was sarcasm, if so I would actually agree.

    ID didn’t predict there would be function in Junk DNA. Michael Behe and myself have said that, and disagreed with the usual claim by Casey Luskin and others that ID predicted functionality in junkDNA.

    ID to the extent it makes a historical claim, doesn’t make predictions since history doesn’t make that many predictions if at all.

  14. You could start by addressing this instead of avoiding it:

    Sal, colewd,

    “Avoiding” is too strong a word, “not trifling” with it is a better characterization.

    That said, Theobold resorts to circular reasoning.

    I could show you a few genes, DNAs, RNAS (16 ribosomal RNAs, aaRS, cytocrhome-C, etc) that form nested taxonomic hierarchies crossing the divide between Eukaryote and Prokaryote.

    Unless it is mechanically feasible to cross the Prokaryote/Eukaryote barriers by common descent (instant evolution of nucleosomes, chromatin remodelers, histones, histone readers writers erasers, spliceosomes, spliceosomal introns, etc.) the nested hierarchy is not evidence of common descent but non-random common design.

    Similarity of genes doesn’t prove mechanical feasibility of common descent. Phylogenetic trees are believable if there is mechanical viability of common descent in the first place. There isn’t a lot of mechanical feasibility in a common ancestor of butterflies, tigers, and blades of grass. Common design strikes me as a better explanation.

  15. stcordova: Unless it is mechanically feasible to cross those barriers (instant evolution of nucleosomes, chromatin remodelers, histones, histone readers writers erasers, spliceosomes, spliceosomal introns, etc.) the nested hierarchy is not evidence of common descent but non-random common design.

    You really are incredibly ignorant of contemporary models of eukaryotic origins. Wrapping the genome up in nucleosomes is an adaptation to large eukaryotic genomes, they didn’t have to appear overnight. The same is true for all the other stuff, such as introns and the spliceosome. Obviously it would be an absurdity to think that eukaryotes suddenly appeared overnight with a genome full of introns, but to way to wrap it up and compress it, and no spliceosome to get rid of the introns. And equally absurd would it be if anyone believed the whole fucking shebang appeared from one cellular generation to the next. (Oh wait, that’s literally what YOU believe).

    Remember, (I know you would dispute this, but it is the theory that) Eukaryotes have their origin at a bacterium becoming an endosymbiont of an archeon. These fellows typically have genomes of a few million base-pairs and neither of them wrap their genomes up in nucleosomes (they basically just supercoil their genomes). The endosymbiont would gradually adapt to becoming what we now recognize as mitochondria, and the host archeon would become a eukaryote with a nucleus. Along with this, the genome would increase in size gradually (because the gradually increasing ATP production capacities of the adapting endosymbiont made this possible), leading to additional methods for genome compression becoming selectively beneficial.

    None of this shit had to appear overnight. There was also not a nucleus to begin with at “eukaryote origins”(which I put in quotes because it’s not a single overnight event, but an evolutionary process stretched over millions of cellular generations), that it is also an adaptation of a byproduct of endosymbiosis. So there’d also not be any need for advanced nuclear pore complexes to evolve transport capacities for an already tightly sealed nucleus. That would also be an absurdity, which is why nobody believes anything like that ever happened.

    At the very least, if you are to critique the theory of evolution, you should bother to learn what it actually postulates happened at the origin and evolution of eukaryotes, rather than your absurd creationist strawman.

  16. OMagain: Or invisible pink unicorns! That’s the trouble with ‘could’

    Once again it illustrates the fact that ID supporters are usually ID supporters despite and not because of the evidence.

    Fer’instance.

    As Sal demonstrates, hyper skeptical of the mechanisms of evolution but has no problem with the lack of mechanism of design,

  17. You really are incredibly ignorant of contemporary models of eukaryotic origins.
    …
    None of this shit had to appear overnight.

    So say evolutionists who think half-functioning spliceosomes will actually work, or half-working double-stranded break mechanism involving inter-histone signaling.

    You want to believe it, I can’t stop you, but let’s not pretend assertions like “None of this shit had to appear overnight” are the same thing as empirical science, it’s not, its speculation pretending to be experimental verification.

    But, I have observational proof on my side. How often do you think out of the buzzillion of prokaryotes on the planet, how often do you think a population of them will start evolving toward something as complex as eukaryote? Suggest some odds — does next to none out of a buzzilion sound about right?

    You want to bet on such remote odds, ok, but that’s not quite the spirit of invoking ordinary and repeatable mechanisms expected of experimental science.

  18. stcordova: how often do you think a population of them will start evolving toward something as complex as eukaryote?

    Maybe once?

    But since it did happen, the odds are one.

    Since neither you nor I have access to the table at the time. it seems rather [pointless to calculate odds. How about ID folks do some actual research?

  19. stcordova: So say evolutionists who think half-functioning spliceosomes will actually work

    This is quite possibly the dumbest strawman of all time. If it is HALF-functioning then of COURSE it won’t work. Stop trying to be obtuse.

  20. stcordova: its speculation pretending to be experimental verification.

    No it isn’t. Nobody is fucking claiming these things have been experimentally verified. It is OPENLY acknowledged that if and when it is speculation, then it is.

    They are models that make predictions, and those predictions are then observationally (or when possible, experimentally) tested. None of this is settled and nobody claims you should believe it as if it was established fact. They are models so far and that is all they are. But you are the one trying to claim evolution could not possibly bridge these so-called gaps, but to make that argument you invent supremely stupid strawmen that noone actually believe or even propose.

    Try to, at the very least, familiarize yourself with what the proposed models actually say, before you try to criticize the theory.

  21. Yes, “mechanically feasible” is Sal’s newest buzzphrase. It can refer to anything you like as long as you are careful not to look at the nature of any required transitions, suppress any form of imagination, and ignore the fossil record (for preservable characters). Nothing to see here, folks, just another iteration of the argument from incredulity and the god of the gaps, in which the gaps must be assiduously maintained.

  22. stcordova: But, I have observational proof on my side.

    What the fuck observation have you made where an organism appeared into thin air, fully formed? None.

    This has never been observed ever of any thing.

    stcordova: How often do you think out of the buzzillion of prokaryotes on the planet, how often do you think a population of them will start evolving toward something as complex as eukaryote? Suggest some odds — does next to none out of a buzzilion sound about right?

    So far as we can gather, it only happened once. So what?

    So far as I can gather, the exact rainstorm that happened last night also happened only once. The precise pattern of wind and movement of air molecules and the precise locations where every drop landed will never repeat itself and has never happened before. Nevertheless, it is all perfectly reasonably to believe was an entirely natural phenomenon explained by the laws of physics acting on the local conditions.

    stcordova: You want to bet on such remote odds, ok, but that’s not quite the spirit of invoking ordinary and repeatable mechanisms expected of experimental science.

    Remote odds? What is the odds of the particular rainstorm that happened last night?

    What is the odds that a designer will make some particular eukaryotic cell? Please describe the properties of the designer such that we can calculate the odds of it designing particular eukaryotic cells.

    It is meaningless to start blathering about odds if the alternative you propose don’t even have odds associated with it, because you are literally incapable of giving any estimations. For an odds-argument to be meaningful you need at least two numbers to compare: the odds on naturalism vs the odds on design. How do you estimate the odds on design? Impress me.

  23. stcordova: “Avoiding” is too strong a word, “not trifling” with it is a better characterization.

    That said, Theobold resorts to circular reasoning.

    Please elaborate.

    Unless it is mechanically feasible to cross the Prokaryote/Eukaryote barriers by common descent (instant evolution of nucleosomes, chromatin remodelers, histones, histone readers writers erasers, spliceosomes, spliceosomal introns, etc.) the nested hierarchy is not evidence of common descent but non-random common design.

    So you’re willing to ignore all evidence of common descent unless you, personally, can imagine a scenario for the evolution of all characters. Can you imagine a world that isn’t limited by the power of your imagination? Isn’t this a suspiciously convenient excuse for dismissing evidence?

    And what is this “non-random common design”? Are you suggesting that god would create a nested hierarchy (not just similar design, you understand) for some comprehensible reason? If so, what would it be?

    There isn’t a lot of mechanical feasibility in a common ancestor of butterflies, tigers, and blades of grass.Common design strikes me as a better explanation.

    How have you assessed “mechanical feasibility” in the case above? And how does “common design” explain anything, much less a nested hierarchy?

  24. Rumraket,

    None of this shit had to appear overnight. There was also not a nucleus to begin with at “eukaryote origins”(which I put in quotes because it’s not a single overnight event, but an evolutionary process stretched over millions of cellular generations), that it is also an adaptation of a byproduct of endosymbiosis. So there’d also not be any need for advanced nuclear pore complexes to evolve transport capacities for an already tightly sealed nucleus. That would also be an absurdity, which is why nobody believes anything like that ever happened.

    The origin of the eukaryotic cell seems more difficult then origin of life to explain, at least from the perspective of developing new sequences. I have never read an account of it that has any non speculative detail to it. Do you think anyone has made a good account of this event or set of events?

  25. colewd: The origin of the eukaryotic cell seems more difficult then origin of life to explain, at least from the perspective of developing new sequences. I have never read an account of it that has any non speculative detail to it. Do you think anyone has made a good account of this event or set of events?

    Can you produce an account with equal or greater detail of fiat creation of eukaryotes? Or do you just demand detailed scenarios as a way to avoid looking at evidence?

  26. colewd: The origin of the eukaryotic cell seems more difficult then origin of life to explain, at least from the perspective of developing new sequences.

    I completely disagree. I think the origin of life is a much, much harder problem, because to a large extent we can’t rely on natural selection until there’s some sort of replication and selection going. This makes it a much harder problem both experimentally and theoretically.

    colewd: I have never read an account of it that has any non speculative detail to it.

    Me too. It is almost entirely speculation, with some sporadic phylogenetic and population genetic support. But at least we have some well-known mechanisms to rely on, we don’t have to postulate something unobserved to bridge this gap. Models are being made that predict stuff and they are being observationally tested.

    colewd: Do you think anyone has made a good account of this event or set of events?

    I have read a good account of it, yes. A speculative account to be sure, but an account none the less and one that actually explains the various aspects of eukaryotes that separate them from prokaryotes. Read Nick Lane’s The Vital Question: Why is life the way it is?

  27. colewd: The origin of the eukaryotic cell seems more difficult then origin of life to explain…

    That’s an odd view. Origin of life is a much tougher nut to crack.

    ETA I see Rumraket got there first.

  28. @ colewd

    I can endorse Rumraket’s book recommendation too. Nick Lane is lucid if optimistic.

  29. @ colewd

    Catching up, I promised to respond to any earlier comment of yours but I see others have covered the points better than I might have done. Feel free to repeat a question you’d still like answering.

  30. It takes a designer in order to make life with all of the derivativeness, limitations, vestiges of past functions, and blindness to innovations in separate clades, that one would expect if there were no designer.

    Have I got the ID position just about right?

    Glen Davidson

  31. Alan Fox,

    That’s an odd view. Origin of life is a much tougher nut to crack.

    I am not sure I disagree with this but am interested in a discussion here. There are many chemical origin issues with the first cell but I think the sequence or what some call the information problem may get worse over time. If for discussion sake we call first life the minimum configuration that Craig Vintner has come with, 500 genes. We indeed have a large sequence problem especially trying to evolve sequences for a replication system micro machine like the ribosome. We also need a power generating micro machine ATP synthase. Plus all the enzymes that speed up chemical reactions. We also need the sequences that signal replication. I think natural selection can build simple sequences but when the length gets above 20 to get advantage with 10 different amino acid types then the odds of getting lost in search space is much greater then finding function. As we move forward Allan Millers argument of short sequences and small amino acid counts goes away.

    So now we need to evolve a eukaryotic cell. We can explain mitochondria through endosymbiosis of mutated bacteria but then we have several innovations whose sequences are much larger then the ribosome or ATP synthase. The spliceosome, the nuclear pore complex and chromatin structures that require complex epigenetic control of transcriptional proteins. All these mechanisms work together and take up millions of genome nucleotide sequences. From a sequence building standpoint this appears to be more complex then the evolution of the first cell.

  32. colewd: I am not sure I disagree with this but am interested in a discussion here. There are many chemical origin issues with the first cell but I think the sequence or what some call the information problem may get worse over time. …

    I’m not going to bother with speculating on the origin of life because the unknowns are so many. All I want to say is that I think an overarching mistake you are making is to assume an entire functional (albeit a “simple” one with a few hundred genes) cell must somehow appear in a single event. I don’t believe this is what happened and no concemporary attempt at a model for the origin of life is working on that assumption.

    colewd: So now we need to evolve a eukaryotic cell. We can explain mitochondria through endosymbiosis of mutated bacteria but then we have several innovations whose sequences are much larger then the ribosome or ATP synthase. The spliceosome, the nuclear pore complex and chromatin structures that require complex epigenetic control of transcriptional proteins. All these mechanisms work together and take up millions of genome nucleotide sequences. From a sequence building standpoint this appears to be more complex then the evolution of the first cell.

    I agree, from the standpoint of genome size, the difference between the average eukaryote and the average prokaryote, is larger than the difference between “no sequence at all” and the purported “minimal cell”.

    But there’s a really easy (conceptually, I fully acknowledge) solution to this, because we already have evolution at this stage. There’s a genome to work with here already, it doesn’t have to appear de-novo. Mutations are happening already at this stage, we have the basic machinery necessary to make more genes, new genetic material and synthesize proteins and so on.
    One conceivable, super-simple answer would be “lots and lots of gene-duplication”.
    The (highly speculative) model would be something like this: In prokaryotes, these many additional duplications would be quickly lost again because they take energy and time to replicate, energy that needs to be used to create daughter cells and run cellular anabolism and catabolism.
    Give a cell mitochondria, even if only weakly functioning ones, and a large part of this issue is alleviated as the ATP output of the cell is still significantly improved. Now the cell can carry those duplications around with very little issue, so they can evolve new functions. Transposons and introns can proliferate, duplications of enzymes can mutate to combat them(becoming the first parts of what will become the spliceosome). The genome can get larger and more complex, other proteins and enzymes can evolve to help compress and unwind it, through the same mechanism of additionally generated duplications, being rearranged, mutated, fused and so on. All because the cell can produce so much more ATP.

  33. What the fuck observation have you made where an organism appeared into thin air, fully formed? None.

    At least I admit I think the origin event was exceptional, evolutionary theory on the other asserts evolution proceeds in ordinary steps, when in reality, macro-evolutionary steps require miracles too. You guys just don’t want to come to terms that you need the miraculous to make evolutionary theory work, I just challenged you on the problems of prokaryote-eukaryote evolution, and rather responding with arguments of mechanical feasibility, you appealed to baseless assertions.

    Talk about the pot calling the kettle black, you don’t have proof bacteria can turn into birds either. You offer phylogenetic reconstructions as “proof”, but that assumes common descent which assumes it is mechanically feasible in the first place for bacteria to become birds, but in arguing this way that you basically assume the thing you claim to be trying to prove. Which is circular.

    You really don’t see the circuitousness of your line of reasoning. At least I’m willing to admit an exceptional event, probably happening only once, might be the explanation. There are lots of things like that, like say the origin of the known universe. Happens only once. We accept it even if we can’t repeat it. We accept it by inference.

    The problem with evolutionary theory is you pretend it moves forward with ordinary and repeatable mechanisms, but all known direct observations is that bacteria remain like prokaryotes for N generation, where N is a large number.

    But from a practical standpoint, you have yet to show how it has utility for science even if it were true. You all act like no one can understand physics chemistry and medical science without assuming bacteria can evolve into birds. Seems like desperate argument to justify a theory.

    You can assume common descent if you like, and if you said God worked miracles to make fish become birds, then at least you have a story that is more self-consistent than arguing it’s natural for fish to evolve into birds. What is evidently natural:

    1. life comes from life, not non-life
    2. birds give birth to birds, fish to fish

    That’s natural. What you describe is un-natural, but you’re unwilling to admit it.

  34. stcordova: 1. life comes from life, not non-life
    2. birds give birth to birds, fish to fish

    That’s natural. What you describe is un-natural, but you’re unwilling to admit it.

    No, sorry, it’s evolution that has life coming from life (evolution requires reproducing life).

    It’s you who has life coming from non-life as a routine source of innovation.

    When you can’t even keep this basic fact straight, it’s not surprising that you don’t make much sense on the rest.

    Glen Davidson

  35. stcordova: You offer phylogenetic reconstructions as “proof”, but that assumes common descent which assumes it is mechanically feasible in the first place for bacteria to become birds, but in arguing this way that you basically assume the thing you claim to be trying to prove. Which is circular.

    This single post demonstrates your ignorance of many subjects. Let’s enumerate some.

    If you suppose that phylogenetic analyses assume what they’re trying to prove (setting aside your inappropriate introduction of the word “proof”), then you know nothing about phylogenetic analysis. But I think we had established that already.

    At least I’m willing to admit an exceptional event, probably happening only once, might be the explanation. There are lots of things like that, like say the origin of the known universe. Happens only once. We accept it even if we can’t repeat it. We accept it by inference.

    Yes, just as, in science, we accept everything by inference. Here you implicitly repeat your misunderstanding that lab experiments are a superior form of science to all others. Of course the origin of the known universe has provided us with evidence, while your hypothetical creation events have not. “I’m supposing that something happened, don’t know when, don’t know what, don’t know how” is not an explanation.

    But from a practical standpoint, you have yet to show how it has utility for science even if it were true.

    It would seem to me that just being true, accompanied by evidence that it’s true, is of itself utility for science. Science is, after all, the process of making reliable inferences about reality. Greater understanding of biology, which does include the history of life, is something to be sought for its own sake. Even if it doesn’t cure the common cold or make more efficient toasters.

    2. birds give birth to birds, fish to fish

    I swear you’re repeating the old creationist model of dogs giving birth to cats. What part of “gradual” is unclear to you? The differences between generations are slight, and major changes take time. Further, are you saying here that birds are a single “kind” and fish are a single “kind”, so that any differences within those groups are something evolution could do?

    Finally a quibble, though it does help to illuminate your ignorance of biology: birds and most fish don’t give birth. They lay eggs. Most fish even have external fertilization.

  36. Rumraket,

    Give a cell mitochondria, even if only weakly functioning ones, and a large part of this issue is alleviated as the ATP output of the cell is still significantly improved. Now the cell can carry those duplications around with very little issue, so they can evolve new functions.

    First, I like your reasoning but the above is where I get stuck.
    How does a duplicated gene find a new function especially when it is larger then 20 amino acids long? This is 20^20 of sequential space. The odds of degradation are orders of magnitude larger then the odds of finding function. This is like getting even odds on lotto tickets and hoping you will win over time. This is why I think the eukaryotic transition is so tough because we a talking about 20^10000000 of sequential space to work through who’s incremental steps are 20^500 being the components of the spliceosome or NPC. These numbers are orders of magnitude larger then the evolutionary resources to work through the problem even in increments over time.

  37. stcordova: At least I admit I think the origin event was exceptional, evolutionary theory on the other asserts evolution proceeds in ordinary steps, when in reality, macro-evolutionary steps require miracles too.

    Macro-evolutionary “steps” are not single origin events. They are perfectly reasonable to explain as proceeding through ordinary gradualistic evolution. Nobody is saying a bacterium became a fully functioning eukaryote from one day to the next, and nobody is claiming a fish spawned a fucking cow or a bird.

    What you’re doing is looking at each end of a spectrum and claiming it would take a miracle to go from one end to the other in a single step. But that’s not what happened and nobody claims this is what happened. It only appears miraculous when you INSIST on ignoring the MANIFESTLY REAL transitional fossils that bridge these transitions.

    stcordova: You guys just don’t want to come to terms that you need the miraculous to make evolutionary theory work, I just challenged you on the problems of prokaryote-eukaryote evolution, and rather responding with arguments of mechanical feasibility, you appealed to baseless assertions.

    What an idiotic complaint. You are asking us to explain the origin of eukaryotes, by referring to it as a single miraculous event. Then we give you gradualistic models (thus avoiding the “miracle” strawman you built) that agree with evolutionary theory and you complain they are speculative.

    stcordova: Talk about the pot calling the kettle black, you don’t have proof bacteria can turn into birds either.

    Proof? No, we have evidence.

    stcordova: You offer phylogenetic reconstructions as “proof”

    No, as evidence, not “proof”.

    stcordova: but that assumes common descent

    No, it DEMONSTRATES common descent.

    See my very long post in this thread. Read it nine times at least.

    stcordova: which assumes it is mechanically feasible in the first place for bacteria to become birds

    Bacteria become birds because that is what the evidence implies. Evidence that only makes sense on evolution, evidence you can only account for with a non-predictive ad-hoc “design” rationalization.

    If creationism was really true, there’d be no reason to expect a small team of geologists and paleontologists to predict the existence of a specific morphological transition to exist in a specific strata of rock, exposed and accessible in the Canadian arctic. Yet evolution absolutely required it.

    stcordova: but in arguing this way that you basically assume the thing you claim to be trying to prove. Which is circular.

    False. Our ability to construct these phylogenies and their overwhelming corroboration by the fossil record imply that common descent is real and that it happened through the evolutionary process of descent with modification, because only descent with modification requires and predicts there to even BE reconstructible phylogenies (and the rough chronology of fossil series) in the first place.

    stcordova: At least I’m willing to admit an exceptional event, probably happening only once, might be the explanation.

    But that is literally what we are doing. The bacterial-archaeal endosymbiotic event that gave rise to eukaryotes is an exceptionally rare event that probably only happened once. And?

    stcordova: The problem with evolutionary theory is you pretend it moves forward with ordinary and repeatable mechanisms

    It OBSERVATIONALLY moves forward with ordinary and repeatable mechanisms.

    stcordova: but all known direct observations is that bacteria remain like prokaryotes for N generation, where N is a large number.

    Things that happen once, happen once. Things that happen twice, happen twice. Things that happen a trillion times a day happen a trillion times a day. What can we conclude from this? Not a fucking thing. You literally could not make a worse argument. The origin of eukaryotes was a rare event. SO FUCKING WHAT?

    So far as I can gather, the exact rainstorm that happened last night also happened only once. The precise pattern of wind and movement of air molecules and the precise locations where every drop landed will never repeat itself and has never happened before. Nevertheless, it is all perfectly reasonably to believe was an entirely natural phenomenon explained by the laws of physics acting on the local conditions.

    stcordova: But from a practical standpoint, you have yet to show how it has utility for science even if it were true.

    For my own part I could not give any less of a fuck whether you think doing research into evolutionary history has any merit. It is interesting and that is enough. Human beings are curious creatures. We like to find out stuff, it brings us pleasure and happiness to wonder and to investigate. Merely knowing and working to find out is it’s own reward. It doesn’t HAVE to produce vaccines, iphones, cancer-cures or supersonic jets for it to be worth doing. You might as well, then, tear down every museum of art, every sculpture, every piece of old architecture and destroy every scene of musical and acting performance since, apparently, they aren’t “useful for science” either.

    stcordova: You all act like no one can understand physics chemistry and medical science without assuming bacteria can evolve into birds.

    We do? Where? Please quote here where someone literally does that very thing. Acts like “no on can understand physics chemistry and medical science without assuming bacteria can evolve into birds.”

    Got any other halluscinated nuttery to impress upon us?

    stcordova: Seems like desperate argument to justify a theory.

    .. if somebody made it.

    stcordova: You can assume common descent if you like

    It isn’t assumed. It is overwhelmingly implied by the evidence.

    stcordova: and if you said God worked miracles to make fish become birds, then at least you have a story that is more self-consistent than arguing it’s natural for fish to evolve into birds.

    No, that would not be consistent at all. It would be utterly idiotic and deluded.

    stcordova: What is evidently natural:

    1. life comes from life, not non-life

    Yes, but it could not have always existed. Because even if it didn’t start on Earth, the evidence tells us there’s a time in the history of the universe before the elements required for life as we know it didn’t even exist. That means, working merely from things we observe exist (matter, stars, planets), at some point life MUST have come from non-life. We don’t know how and we don’t pretend we know how.

    stcordova: 2. birds give birth to birds, fish to fish

    With mutations in their genomes. And they’re subject to natural selection and genetic drift. So they change over time. It is an observational fact. And if they really did so in the past too, then with some luck (if it happened to fossilize), there should exist the fossil of a species of transitional fish, morphologically intermediate between lobe-finned fish and terrestrial tetrapods.

    There are thousands of such predictions of evolution that have been tested.

    Creationism makes no such predictions.

    stcordova: That’s natural.

    To change over time? I agree. Nothing stays exactly the same forever. Everything changes and some things change more than others. That is the natural way of things.

  38. John Harshman,

    stcordova: You offer phylogenetic reconstructions as “proof”, but that assumes common descent which assumes it is mechanically feasible in the first place for bacteria to become birds, but in arguing this way that you basically assume the thing you claim to be trying to prove. Which is circular.

    This single post demonstrates your ignorance of many subjects. Let’s enumerate some.

    If you suppose that phylogenetic analyses assume what they’re trying to prove (setting aside your inappropriate introduction of the word “proof”), then you know nothing about phylogenetic analysis. But I think we had established that already.

    How does phylogenetic analysis establish decedents and their common ancestor?

  39. stcordova,

    Unless it is mechanically feasible to cross the Prokaryote/Eukaryote barriers by common descent (instant evolution of nucleosomes, chromatin remodelers, histones, histone readers writers erasers, spliceosomes, spliceosomal introns, etc.) the nested hierarchy is not evidence of common descent but non-random common design.

    That is ridiculous. Both parts.

  40. colewd:
    John Harshman,
    How does phylogenetic analysis establish decedents and their common ancestor?

    Not quite sure what you mean. Could you try another question, taking great care this time to be clear?

  41. colewd: First, I like your reasoning but the above is where I get stuck.
    How does a duplicated gene find a new function especially when it is larger then 20 amino acids long? This is 20^20 of sequential space. The odds of degradation are orders of magnitude larger then the odds of finding function. This is like getting even odds on lotto tickets and hoping you will win over time. This is why I think the eukaryotic transition is so tough because we a talking about 20^10000000 of sequential space to work through who’s incremental steps are 20^500 being the components of the spliceosome or NPC. These numbers are orders of magnitude larger then the evolutionary resources to work through the problem even in increments over time.

    For any single arbitrarily picked function, approximately 1 in 10^11 randomly generated sequences 80 amino acids in length will have that function.

    This rate doesn’t seem to change significantly regardless of sequence length. So despite the sequential space being huge, it is REPLETE with function. So new function is relatively easily discovered.

    Notice, it is for a single function. How many possible functions are there? Hundreds of thousands? Millions? Pick one of them and you will find a sequence that can do it in a pool of randomly generated proteins of about 100 billion.

    Said in other words: Your issue is the assumption that the fraction of sequence space that is functional is so tiny it is impossible to cross the distances between functional sequences by accumulations of mutations. This assumption has been proven empirically wrong multiple times.

  42. stcordova,

    Similarity of genes doesn’t prove mechanical feasibility of common descent. Phylogenetic trees are believable if there is mechanical viability of common descent in the first place. There isn’t a lot of mechanical feasibility in a common ancestor of butterflies, tigers, and blades of grass. Common design strikes me as a better explanation.

    This perhaps because you are incapable – or have trained yourself to be so – of thinking of the implications of a branching process. “The twigs are nothing like each other so there’s no way … yes, I know but look at the twigs!”

    It’s not just ‘similarity’, it is the degree of sequence identity. If you accept it as common descent at a certain taxonomic distance, but common design at another, but have nothing but imagined difficulties at the eukaryoye/prokaryote boundary to offer as the point one becomes the other, then you are just blowing smoke, as I believe it is put.

  43. Regarding imaginary barriers to evolution, an excerpt from an old OP:

    One final point. Most IDers concede that if the evidence supports unguided evolution, then there is no scientific reason to invoke a Creator or Designer. (It’s Occam’s Razor — why posit a superfluous Creator/Designer if the evidence can be explained without one?) It is therefore not enough for ID to succeed at explaining the evidence (which it fails to do, for the reasons given above); it’s also essential for unguided evolution to fail at explaining the evidence.

    This is a big problem for IDers. They concede that unguided evolution can bring about microevolutionary changes, but they claim that it cannot be responsible for macroevolutionary changes. Yet they give no plausible reasons why microevolutionary changes, accumulating over a long period of time, should fail to produce macroevolutionary changes. All they can assert is that somehow there is a barrier that prevents microevolution from accumulating and turning into macroevolution.

    Having invented a barrier, they must invent a Designer to surmount it. And having invented a Designer, they must arbitrarily constrain his behavior (as explained above) to match the data. Three wild, unsupported assumptions: 1) that a barrier exists; 2) that a Designer exists; and 3) that the Designer always acts in ways that mimic evolution. (We often hear that evolution is a designer mimic, so it’s amusing to ponder a Designer who is an evolution mimic.) Unguided evolution requires no such wild assumptions in order to explain the data. Since it doesn’t require these arbitrary assumptions, it is superior to ID as an explanation.

    Here’s an analogy that may help. Imagine you live during the time of Newton. You hear that he’s got this crazy idea that gravity, the force that makes things fall on earth, is also responsible for the orbits of the moon around the earth and of the earth and the other planets around the sun. You scoff, because you’re convinced that there is an invisible, undetected barrier around the earth, outside of which gravity cannot operate. Because of this barrier, you are convinced of the need for angels to explain why the moon and the planets follow the paths they do. If they weren’t pushed by angels, they would go in straight lines. And because the moon and planets follow the paths they do, which are the same paths predicted by Newton on the basis of gravity, you assume that the angels always choose those paths, even though there are trillions of other paths available to them.

    Instead of extrapolating from earthly gravity to cosmic gravity, you assume there is a mysterious barrier. Because of the barrier, you invent angels. And once you invent angels, you have to restrict their behavior so that planetary paths match what would have been produced by gravity. Your angels end up being gravity mimics. Laughable, isn’t it?

    Yet the ‘logic’ of ID is exactly the same. Instead of extrapolating from microevolution to macroevolution, IDers assume that there is a mysterious barrier that prevents unguided macroevolution from happening. Then they invent a Designer to leap across the barrier. Then they restrict the Designer’s behavior to match the evidence, which just happens to be what we would expect to see if unguided macroevolution were operating. The Designer ends up being an unguided evolution mimic.

    The problem is stark. ID is trillions of times worse than unguided evolution at explaining the evidence, and the only way to achieve parity is to tack wild and unsupported assumptions onto it.

  44. colewd,

    I agree with this. At what point does sequence divergence lower the probability of common decent?

    Why do you people insist on dichotomising a continuum?

    If one had an ancestral sequence and randomly changed bits in both of two descendant lines, the similarity between them at successive times would diminish until it was a bitwise 25% or so, indistinguishable from random. The probability of common descent in this scenario is 100%, because that’s what happened. But the information content of the strings regarding this fact diminishes with time at different rates, until it disappears altogether, due to the very nature of the evolutionary process.

    If one has no signal at all, string comparisons are uninformative. It is done to investigate relationships, not to investigate cases where no information on relationship remains. But if one wishes instead to insist that for some apparent homologies common design is at work, not descent, one ought to offer a means by which common design can be distinguished from common descent.

    Because there is absolutely no need on Design for two organisms to appear related throughout their genome, and for that relationship to accord with an apparent phylogeny (such as you might allow as ‘real’ if the same analysis was done on two similar species). And if one allows evolution up to a point, there ought to be a clear boundary where the assumptions breaks down. This, after all, is how LGT and gene loss events are uncovered, by their anomalous nature. The signal of Design or Creation should be capable of targetting by phylogenetic analysis. Yet no-one seems to be working on this.

  45. phoodoo,

    Me: Strange you don’t find many actual biologists or biochemists coming to this conclusion.

    phoodoo: Except for all that ones that do of course.

    Well … yeah. Congratulations on working through the implications of the concept ‘not many’.

  46. Rumraket,

    For any single arbitrarily picked function, approximately 1 in 10^11 randomly generated sequences 80 amino acids in length will have that function.

    This rate doesn’t seem to change significantly regardless of sequence length. So despite the sequential space being huge, it is REPLETE with function. So new function is relatively easily discovered.

    Notice, it is for a single function. How many possible functions are there? Hundreds of thousands? Millions? Pick one of them and you will find a sequence that can do it in a pool of randomly generated proteins of about 100 billion.

    Said in other words: Your issue is the assumption that the fraction of sequence space that is functional is so tiny it is impossible to cross the distances between functional sequences by accumulations of mutations. This assumption has been proven empirically wrong multiple times.

    If I were to assume your numbers are right and agree we are only evolving binding to ATP at this point. How would with 1/10^11 odds of function not statistically degrade the sequence over time? This is one chance in 100 billion of binding to ATP.

    Said in other words: Your issue is the assumption that the fraction of sequence space that is functional is so tiny it is impossible to cross the distances between functional sequences by accumulations of mutations. This assumption has been proven empirically wrong multiple times.

    Do you really believe this is proof? I agree it is a counter argument.

  47. colewd: Do you really believe this is proof?

    It’s been demonstrated empirically. Surely that’s proof?

    colewd: This is one chance in 100 billion of binding to ATP.

    How many ones have you got?

  48. Allan Miller,

    If one had an ancestral sequence and randomly changed bits in both of two descendant lines, the similarity between them at successive times would diminish until it was a bitwise 25% or so, indistinguishable from random. The probability of common descent in this scenario is 100%, because that’s what happened.

    You are confirming Sal’s thesis that UCD is a circular argument.

  49. colewd: You are confirming Sal’s thesis that UCD is a circular argument.

    You have ignored the nesting part of the changes. In other words, you have ignored the only relevant part of the discussion.

Leave a Reply