First off I must apologize for doing another post on a subject that’s been done to death around here, but I’ve been meaning to make a post about this for a while but other stuff kept coming up. Anyway, things have quietened down at work where I now only have to maintain some cell cultures, so I have a bit of time duing the christmas holiday.
My post, which is a repost of something I also brought up in a thread on Larry Moran’s sandwalk blog, is about a chapter in Stephen Meyer’s book Darwin’s Doubt and what I can, if I’m being generous, only attribute to extremely shoddy scholarship.
Having read the book, a recurring phenomenon is that Meyer time and again makes claims without providing any references for them. Take for instance the claim that the Cambrian explosion requires lots of new protein folds, from Chapter 10 The Origin of Genes and Proteins:
“Axe had a key insight that animated the development of his experimental program. He wanted to focus on the problem of the origin of new protein folds and the genetic information necessary to produce them as a critical test of the neo-Darwinian mechanism. Proteins comprise at least three distinct levels of structure:4 primary, secondary, and tertiary, the latter corresponding to a protein fold. The specific sequence of amino acids in a protein or polypeptide chain make up its primary structure. The recurring structural motifs such as alpha helices and beta strands that arise from specific sequences of amino acids constitute its secondary structure. The larger folds or “domains” that form from these secondary structures are called tertiary structures (see Fig. 10.2).
Axe knew that as new life-forms arose during the history of life—in events such as the Cambrian explosion—many new proteins must also have arisen. New animals typically have new organs and cell types, and new cell types often call for new proteins to service them. In some cases new proteins, while functionally new, would perform their different functions with essentially the same fold or tertiary structure as earlier proteins. But more often, proteins capable of performing new functions require new folds to perform these functions. That means that explosions of new life-forms must have involved bursts of new protein folds as well.”
In the whole section Meyer dedicates to the origin of novel folds, he makes zero references that actually substantiates that the cambrian diversification, or indeed any kind of speciation, or the that new cells types or organs, requires new protein folds. ZERO. Not one single reference that supports these claims. At first It reads like what I quote above, lots of claims, no references. Later on he eventually cites the work of Douglas Axe that attepts to address how hard it is to evolve new folds(and that work has it’s own set of problems, but never mind that). Axe makes the same claim in his ID-journal Bio-complexity papers (which eventually Meyers cites), but in Axe’s papers, that claim is not supported by any reference either. It’s simply asserted as fact. In other words, Meyer makes a claim, then cites Axe making the same claim. Neither of them give a reference.
Meyer mentions Ohno:
“The late geneticist and evolutionary biologist Susumu Ohno noted that Cambrian animals required complex new proteins such as, for example, lysyl oxidase in order to support their stout body structures. When these molecules originated in Cambrian animals, they also likely represented a completely novel folded structure unlike anything present in Precambrian forms of life such as sponges or one-celled organisms. Thus, Axe was convinced that explaining the kind of innovation that occurred during the Cambrian explosion and many other events in the history of life required a mechanism that could produce, at least, distinctly new protein folds.”
No reference is given here either. The claim is simply made initially, so it’s hard to check. Is Meyer and Axe willing to bet that a preceding evolutionary history of, for example, Lysyl oxidase cannot be found in structure and sequence of related molecules? That there ARE no related molecules? Is that his claim? That the Cambrian explosion required tonnes of bona fide Orphan proteins with no preceding history? Where are the references that support this? Did Meyer or Axe look for homologues of Lysyl Oxidase and found none?
It gets much worse, turns out Meyer is making assertions diametrically opposite to what his very very few references say. Remember what Meyer wrote above?
“The late geneticist and evolutionary biologist Susumu Ohno noted that Cambrian animals required complex new proteins such as, for example, lysyl oxidase in order to support their stout body structures.”
Well, much later in the same chapter, Meyer finally references Ohno:
“Third, building new animal forms requires generating far more than just one protein of modest length. New Cambrian animals would have required proteins much longer than 150 amino acids to perform necessary, specialized functions.21”
What is reference 21? It’s “21. Ohno, “The Notion of the Cambrian Pananimalia Genome.”
What does that reference say? Let’s look:
“Reasons for Invoking the Presence of the Cambrian Pananimalia Genome.
Assuming the spontaneous mutation rate to be generous 10^-9 per base pair per year and also assuming no negative interference by natural selection, it still takes 10 million years to undergo 1% change in DNA base sequences. It follows that 6-10 million years in the evolutionary time scale is but a blink of an eye. The Cambrian explosion denoting the almost simultaneous emergence of nearly all the extant phyla of the kingdom Animalia within the time span of 6-10 million years can’t possibly be explained by mutational divergence of individual gene functions. Rather, it is more likely that all the animals involved in the Cambrian explosion were endowed with nearly the identical genome, with enormous morphological diversities displayed by multitudes of animal phyla being due to differential usages of the identical set of genes. This is the very reason for my proposal of the Cambrian pananimalia genome. This genome must have necessarily been related to those of Ediacarian predecessors, representing the phyla Porifera and Coelenterata, and possibly Annelida. Being related to the genome – possessed by the first set of multicellular organisms to emerge on this earth, it had to be rather modest in size. It should be recalled that the genome of modern day tunicates, representing subphylum Urochordata, is made of 1.8 x 10^8 DNA base pairs, which amounts to only 6% of the
mammalian genome (9). The following are the more pertinent of the genes that were certain to have been included in the Cambrian pananimalia genome.”
The bold is my emphasis. I trust you can see the problem here. So, Meyer makes a single goddamn reference to support the claim that the Cambrian explosion required a lot of innovation of new proteins, folds, cell-types and so on. What do we find in that references? That Ohno is suggesting the direct opposite, that he is in fact supporting the standard evo-devo view that few regulatory changes were what happened, that the genes and proteins were already present and had long preceding evolutionary histories.
Later Meyer gets a ID-complexitygasm when he asserts, again without any support, that:
“The Cambrian animals exhibit structures that would have required many new types of cells, each requiring many novel proteins to perform their specialized functions. But new cell types require not just one or two new proteins, but coordinated systems of proteins to perform their distinctive cellular functions.”
Where does he get this? His ass, that’s where.
…since the first appearance of bacterial life on earth…a total of about 10^40 organisms have lived on earth since life first appeared.
…the actual number of new sequences sampled in the history of life…
…to search sequence space in the history of life.
…every organism from the dawn of time…
– Darwin’s Doubt p. 203
…each organism that has ever lived during the history of life…
…a space that could not be explored by this means in the entire history of life on earth, let alone in the few million years of the Cambrian explosion.
– Darwin’s Doubt p. 204
I trust I have made my point about the time scale involved in the argument of Chapter 10.
Sure, it is clear ID proponents Meyer and Axe believe new protein folds cannot possibly evolve at all, in the entire history of life.
It is also clear Meyer believes lots of them would have HAD to evolve in the cambrian explosion exclusively, because he claims they didn’t exist before.
There is now little doubt that the duplication of Hox clusters and other genes played a crucial role in the emergence of the vertebrate body plan.
– The Evolution of the Genome (p. 715)
Complex multicellular organisms are subject to infection by pathogens (including selfish genetic elements like viruses) and therefore require defensive immune systems.
– The Evolution of the Genome (p. 714)
…genes encoding proteins for cell-cell communications, which are necessary for maintaining the integrity of multicellular organisms, arose by gene duplication. Several gene families are also known to have expanded by duplication as part of the origin and/or early diversification of the metazoa, indicating that both of these major transitions involved a primary influence of gene duplication. From the present perspective, the most important among them are those that play key roles in animal development, most notably homeobox genes, the best known of which are the Hox genes of the Bilataria.
– The Evolution of the Genome (p. 713)
…it has been proposed that, along with exon shuffling, gene duplication may have helped fuel the Cambrian explosion.
– The Evolution of the Genome (p. 714)
And I don’t have any reason to think Meyer is off on his own little island. I have little doubt that I can continue to provide support for his claims, including new genes, new proteins, new cell types, new tissues, new organs, etc. etc.
Exon shuffling, what would that result in?
As far as I can see you have provided no support for Meyer’s claims. You have merely quoted this or that paragraph that is irrelevant to Meyer’s claims, without even any argument to connect it to those claims. I’m pretty sure nobody else sees what you think you’re seeing in those quotes. Perhaps if you were more explicit?
No, I am not conflating them. And I know they are different.
I am doing no such thing. I know the difference.
Since I am not conflating anything it’s not Meyer’s fault.
Yes you do, because you’ve yet to supply any support for the claim. You keep believing, apparently on little more than just blind faith, that Meyer is right about that claim.
He isn’t. I’ve given multiple references, already on the very first page of this entire thread, that support that I’m right and Meyer is wrong.
I see Rumraket’s post has been spotted by Vincent Torley who has posted a brief* OP at Uncommon Descent.
*brief on the Torley scale.
Following links back to Rumrakets’ original comments at Sandwalk I see he has referenced this paper by Janet Thornton et al. It seems to eloquently address the issue of protein family evolution and the concerns of Stephen Meyer.
He doesn’t give a single reference that shows the cambrian diversification required new protein folds to evolve.
He asks in his title “Do new cell types require new kinds of proteins?”
What’s a “new kind” of protein? We’re talking about folds, Vincent.
Reference one, talks about “Clusters of Differentiation (CD) are cell surface proteins used to differentiate one cell type from another.” What new folds are there in these, Vincent? Did they originate in the cambrian explosion?
Reference two (P. V. Sukumaran 2004), first quote supplied by Vincent talks about cell types, not protein folds, so is irrelevant. The second quote (after the 2.5-page ellipsis) merely regurgitates Meyers claim, does not provide any evidence that it is true.
The third reference does not show that any of the genes talked about utilize any novel folds, or that they originated in the Cambrian Exlosion. There’s a lot of blather about the endosymbionts like mitochondria and several organelles, the nucleosome spooling used in eukaryotes, but eukaryotes in general are extremely old and predate the cambrian explosion by up to 1.5 billion years. None of the features mentioned are uniquely cambrian and no evidence that they are produced by protein folds with no ancestors in the precambrian is provided.
Then follows a lot of totally irrelevant blather about genome size increases. Nothing about novel protein folds emerging in the Cambrian Explosion.
Then he blathers about teleology and the Cambrian Explosion, to try and divert attention from the demonstrated fact that Meyer deceptively references Ohno in support of a claim Ohno does not, in fact, support. Who the hell cares that Meyer was aware of Ohno in 2001 proposing a pananimalian cambrian genome WHEN THIS IS THE VERY THING MEYER IS ARGUING AGAINST, YET IS CITING OHNO IN SUPPORT OF? That just MAKES IT EVEN WORSE that he cites Ohno.
Matzke nails it in the very first paragraph in the very first response. Vincent is blathering about irrelevancies. Well, at least he corrected some of my grammar and spelling 😛
This is Epic, I will show this thread and Torley’s response on all rationalist forums I frequent.
stcordova,
If one starts with 100% similarity and amends random positions, it is inevitable that the % similarity will go down, and the similarities must inevitably be eroded, to be replaced largely by differences. It’s the same as a radioisotope – each atom that decays is one less atom of the original. There must come a point where none is left. The phylogeny is real, but the molecules reveal none of it. One has to be aware of this tendency, and allow for it.
It is also clear – as with isotopes – that the rate of decay will vary. For any pair, one can always show a better fit, either by picking closer relatives, or regions under greater constraint. But one is not justified in concluding that worse fits are not fits. And there are ways to resolve the question.
At nucleotide level, as one gets down towards 25%, one has to be a little more canny. Whole-gene bit-comparisons become misleading. But it should be obvious that, say,
TAAGCGTAAGCTCCCACGGTGAAC is less similar to TTAATGGCATAACAGCTACGTGAT than to
TAAGCGGTTCACCGTGGGAGCTTA,
despite both having 25% similarity to it lengthwise. (I constructed the second string to be identical in the 1st 6 positions to give the 25% and the remainder to be the antisense of the first string. ie, they are separated by just 1 mutational operation).
And the speed with which one gets to 25% is obviously going to vary. Visual inspection was quite enough with Cytochrome c (when I was at uni, this was the only molecular phylogeny available). And the reason is that Cytochrome c was deeply embedded within cellular process right back at LUCA. Lysyl oxidase was not. Visual inspection, and whole-gene analysis, break down moving from one to the other.
There is nothing precluding a de novo origin for one or more of the LOX loci in animals. But as Meyer’s example of a ‘new protein’, it appears not to fit the bill. And one example is not sufficient to establish the general case, that protein novelty was occurring at a notably elevated rate in the Cambrian.
Mung,
This is hardly a genetic transformation that demands the intervention of a designer on any of the usual ‘too-fast’/’too-far’/’too-big’ lines of ID argumentation.
Mung,
A revision of the usual ‘Hoyle-o-matic’ ID calculation assumptions of function distribution in sequence space?
Mung,
What distinguishes Meyer’s claims of novelty (some degree of novelty being an inevitable consequence of evolution) from anybody else’s?
Alan Fox,
The thing that leaps out at me immediately (I have become sensitised to it) is Torley’s qualification-asymmetry. In one paragraph, we have ‘Dr’ Stephen Meyer, but plain old ‘Larry’ Moran. Joe G does the same with ‘Dr’ Spetner. Of course Spetner and Meyer are physicists, broadly. It’s not wrong, but it is noticeable, the extent to which titular respect is differentially afforded to ID proponents.
I’d love to see some numerical analysis. In place of all this ‘loads/musta/many/here’s one’ crap. “Here’s a protein that is involved in cell adhesion.” Yawn.
It would be a (comparative) piece of cake to assign the 1300 or so SCOP folds by taxonomic group of apparent origin and determine which are unique to animals, and subdivide again to remove those that arose post-Cambrian, and then compare to the equivalent pattern in other groups by age. Confirmation of Meyer’s thesis is at his fingertips.
I’m talking about Meyer’s argument in chapter 10 of Darwin’s Doubt. If you’re talking about something else that would explain a great deal of the apparent miscommunication.
For example, in the OP you accuse Meyer of shoddy scholarship. In return VJT accuses you of shoddy scholarship because you failed to note that Meyer is in fact well aware of the full contents of the Ohno paper and didn’t just read the abstract..
So now you say it’s not about that, that it’s about the protein folds. If it’s not about that, why did you bring it up?
From the OP:
You brought it up, Rumraket.
Mung,
The OP, quoting Meyer:
Meyer is talking about folds, and that is the OP’s focus. There are of course other ways of talking about protein novelty, but you can’t really say ‘it’s not about folds’, when that is exactly what Meyer says it is about.
From the OP:
You brought it up, Rumraket. You claimed Meyer was just pulling these claims out of his ass. And when people show that Meyer isn’t just pulling these claims out of his ass, then you want to make it about protein folds and only protein folds.
Perhaps you should start a new thread on just that one issue. Allan’s made a neat suggestion here.
Mung,
My suggestion is work that Meyer could/should have performed to support his contention. I’m not sure it’s up to Mikkel to do this. Meyer is the one advancing the thesis.
I didn’t not say that it’s not about folds. Protein folds is certainly part of his argument in chapter 10. But it is not just about folds either, and neither is the OP just about folds, as I have shown.
Mung,
Nonetheless, the OP is [predominately] about folds, among the numerous critiques of Meyer’s book that are available.
Yes, well, let’s not make this about who should do what when the point was that if Rumraket want’s to make it about protein folds and only about protein folds he should have written a different OP than the one currently before us.
I’d do the work myself if I knew how, but I don’t know how. It would make a nice science thread here at TSZ if someone wanted to take it up and show us all how it’s done. I know I’d be interested.
How did you ascertain that the OP is [predominantly] about protein folds? I thought it was [predominantly] about Meyer being a hack. 🙂
That seems to be how Elizabeth took it too.
Mung,
Although things other than protein folds are mentioned, the bulk of the OP is about them. That Torley should pen a critique (particularly one with such an in-yer-face title) and not mention them is certainly worthy of note.
Noted.
I have extensively quoted what I’m talking about, to you, personally, in this very thread. I did so in the op, I’m doing it here.
(Yes, that are three seperate links to me explaining to you in direct response that it is about protein folds and the cambrian explosion, you cannot NOT get it at this point. If you still don’t, seek professional help).
It’s about protein folds and the cambrian explosion, it’s always been about protein folds and the cambrian explosion.
Which is why the first thing I explicitly state is a problem with Meyer’s chapter ten is:
You, Meyer, Torley. None of you have produced such a reference.
And I succeed in carrying that accusation through to the conclusion that it IS shoddy scholarship.
Meyer:
1. Fails to cite any evidence that supports the claim, that:
And:
You, Torley, Meyer, Cordova:
1. Fail to support it too.
Meyer:
2. Cites Ohno, that argues the opposite.
You, Torley, Meyer, Cordova:
2. Fail to understand this.
This just makes it worse, because then we are absolutely certain that Meyer actually read the paper, WHICH THEN MAKES IT AMAZING HE’S CITING IT TO SUPPORT A CLAIM THAT IS OPPOSITE OF THE ONE OHNO MAKES.
Holy fucking shit.
It’s about the protein folds and the cambrian explosion, it’s always been about protein folds and the cambrian explosion, at no point has it NOT been about protein folds and the cambrian explosion. Which it why I constantly quote Meyer talking about protein folds and the cambrian explosion, and his failure of scholarship surrounding protein folds and the cambrian explosion.
And by failure of scholarship I mean:
1. No citations that support the claim.
2. One that argues the opposite, cited as if it supported it.
Mung,
I note your noting.
Yes, I see it’s now time to get a severe case of tunnel vision.
Over at UD gpuccio posted a link to a paper that may be relevant.
The Evolutionary History of Protein Domains Viewed by Species Phylogeny (pdf)
Mung,
Yes, I can see how now is the time to move the goalposts.
What’s an Orphan protein with “no preceding history”, Mung? What do I mean by this? Quick hint: It’s not just an Orphan protein with no sequence similarity found in related organisms. What does it say in context, in the Meyer quote that I’m responding to? Let’s see:
Protein folds originating in the cambrian explosion.
All of my talk about protein folds pre-date the pathetic attempts to save Meyer by selectively reading single sentences out of my OP.
If I’m suffering from tunnelvision towards protein folds, I’ve done so right from the beginning (so it can’t be as a response to anything brought up by any of you). I’m sorry you all failed to catch on, despite me explaining it explicitly several times both right from the beginning and throughout the thread.
Actually so would I. I’m not a professional researcher, Meyer is. Which is why it’s disappointing to see him waste what is probably a very well functioning mind and a lot of time, writing religious apologetics, instead of doing actual research.
Mung,
It is an interesting analysis. I find it supports my own suspicion, that the modern domain ‘library’ was largely complete well before the Cambrian, but that novelty through domain combination continued through it.
From the OP
All that talk about lysyl oxidase. Nothing to do with the OP Got it..
Thank you, this is highly relevant and is exactly the sort of paper Meyer should have been citing when talking about new protein folds being associated with new “life forms”.
While the paper talks about protein domains instead of folds, I think they’re practically the same thing.
According to that paper:
Annoying cliffhanger with the unknown number of possible Orphan domains.
Looking at table it, it seems to show that 58 novel protein domains have originated in Metazoa, with 47 of these in Eumetazoa (If I’m reading this correctly). According to reference 18 in (Yang S, Bourne PE 2009), which took a more in-depth look at Metazoa(I can only access the abstract from home):
Lysyl oxidase is given by meyer as an example of a protein with a novel fold having to have originated in the cambrian explosion. That’s what he cites Ohno for. Who argues the opposite.
It’s highly relevant to the OP.
Mung, you okay buddy?
While the paper that Mung linked to may be interesting, any conclusions it draws must be viewed with deep suspicion due to the obvious use of Microsoft Excel to create many of those graphs. Eww.
oops nvm
More generally, there’s an implicit assumption in much of this that protein evolution was consistently constrained (or consistently unconstrained) throughout its history. That the evolution of new species proceeds at a steady rate, and the numbers of new protein folds correlates with that rate. There’s not really much support for this.
Early in the evolution of protein-coding genomes, it is probable that proteins were rather plastic, and that new functions/folds could be more readily tooled from old. If there was an RNA ribozyme available, no elaborate set of dependent structures, or the protein was not originally vital, protein was under less constraint early on than later. And the library becomes more complete – there is less scope for a new fold; less ‘need’.
But when a particular conformation becomes embedded in an organism, its conformation becomes pinned in place by numerous factors. It becomes, in time, far less labile than it was originally, and therefore far harder to retool. Axe comes along at the end of this ‘brittle-isation’ process (I have had a Christmas drink, so yeah, ‘brittle-isation’!) and discovers that modern proteins are rather brittle, and hence always were. It does not follow.
But it does seem reasonable in principle that domains and folds evolved at a greater rate some time between the origin of protein coding and the start of the Cambrian than they did subsequent to it.
All good points I hadn’t even thought of.
My own suspicions was more along the lines that de novo invention of entirely new protein folds would be much more probable in fast replicating single-celled organisms such as bacteria and the earliest eukaryotes (and perhaps lots of invention in viruses, later transferred to eukaryotes via HGT, as the reference you brought back on pg1 argued).
Rather than them having any greater propensity to emerge in the establishment of new lineages of large multicellular eukaryotes, with their comparatively much smaller population sizes and longer generation times.
Rumraket,
Yep – this too would argue against an expectation of rate increase at the Cambrian. Which increases the need for Meyer to do the analysis, because the effect he seeks should stick out like a sore thumb against all the counter-expectations.
I’m fine, thank you. 🙂
Such balance between erudition and pithiness. How do you do it?
Must… troll… Matzke.